Warning: Use of undefined constant id - assumed 'id' (this will throw an Error in a future version of PHP) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 4

Warning: Use of undefined constant id - assumed 'id' (this will throw an Error in a future version of PHP) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 4

Warning: Use of undefined constant dateiname - assumed 'dateiname' (this will throw an Error in a future version of PHP) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 5

Warning: Use of undefined constant id - assumed 'id' (this will throw an Error in a future version of PHP) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 5

Warning: Use of undefined constant beschreibung - assumed 'beschreibung' (this will throw an Error in a future version of PHP) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 9

Warning: Use of undefined constant typ - assumed 'typ' (this will throw an Error in a future version of PHP) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 10

Warning: Use of undefined constant groesse - assumed 'groesse' (this will throw an Error in a future version of PHP) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 10

Warning: Use of undefined constant download_beschreibung - assumed 'download_beschreibung' (this will throw an Error in a future version of PHP) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 11

Warning: Use of undefined constant dateiname - assumed 'dateiname' (this will throw an Error in a future version of PHP) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 12

Warning: Use of undefined constant downloadname - assumed 'downloadname' (this will throw an Error in a future version of PHP) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 13

Warning: Use of undefined constant dateiname - assumed 'dateiname' (this will throw an Error in a future version of PHP) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 118

Warning: preg_match(): Unknown modifier '|' in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 81

Warning: Cannot modify header information - headers already sent by (output started at /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php:4) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 99

Warning: Cannot modify header information - headers already sent by (output started at /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php:4) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 100

Warning: Cannot modify header information - headers already sent by (output started at /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php:4) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 102

Warning: Cannot modify header information - headers already sent by (output started at /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php:4) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 108

Warning: Cannot modify header information - headers already sent by (output started at /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php:4) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 110
)rExifMM*@@A (129;HMUi$a. zeigt Schattenriss von Bodo Wartke b. Bitte nennen Sie bei Abdruck: Jespen/Bauer/Rosenow; Abdruck nur gegen Namensnennung. c. Weitere Informationen zu Bodo Wartke im Pressebereich unter www.bodowartke.de d. "Swingende Notwendigkeit" ist das sechste Programm von Bodo Wartke. Mehr dazu: www.swingende-notwendigkeit.de -'-'Adobe Photoshop CS6 (Windows)2020:04:15 13:18:22Illustration: Helge Jespen unter Verwendung eines Fotos vonHarald BauerBitte nennen Sie bei Abdruck: Jespen/Bauer/Rosenow; Abdruck nur gegen Namensnennung.0221@@rz(%HH XICC_PROFILE HLinomntrRGB XYZ  1acspMSFTIEC sRGB-HP cprtP3desclwtptbkptrXYZgXYZ,bXYZ@dmndTpdmddvuedLview$lumimeas $tech0 rTRC< gTRC< bTRC< textCopyright (c) 1998 Hewlett-Packard CompanydescsRGB IEC61966-2.1sRGB IEC61966-2.1XYZ QXYZ XYZ o8XYZ bXYZ $descIEC http://www.iec.chIEC http://www.iec.chdesc.IEC 61966-2.1 Default RGB colour space - sRGB.IEC 61966-2.1 Default RGB colour space - sRGBdesc,Reference Viewing Condition in IEC61966-2.1,Reference Viewing Condition in IEC61966-2.1view_. \XYZ L VPWmeassig CRT curv #(-27;@EJOTY^chmrw| %+28>ELRY`gnu| &/8AKT]gqz !-8COZfr~ -;HUcq~ +:IXgw'7HYj{+=Oat 2FZn  % : O d y  ' = T j " 9 Q i  * C \ u & @ Z t .Id %A^z &Ca~1Om&Ed#Cc'Ij4Vx&IlAe@e Ek*Qw;c*R{Gp@j>i  A l !!H!u!!!"'"U"""# #8#f###$$M$|$$% %8%h%%%&'&W&&&''I'z''( (?(q(())8)k))**5*h**++6+i++,,9,n,,- -A-v--..L.../$/Z///050l0011J1112*2c223 3F3334+4e4455M555676r667$7`7788P8899B999:6:t::;-;k;;<' >`>>?!?a??@#@d@@A)AjAAB0BrBBC:C}CDDGDDEEUEEF"FgFFG5G{GHHKHHIIcIIJ7J}JK KSKKL*LrLMMJMMN%NnNOOIOOP'PqPQQPQQR1R|RSS_SSTBTTU(UuUVV\VVWDWWX/X}XYYiYZZVZZ[E[[\5\\]']x]^^l^__a_``W``aOaabIbbcCccd@dde=eef=ffg=ggh?hhiCiijHjjkOkklWlmm`mnnknooxop+ppq:qqrKrss]sttptu(uuv>vvwVwxxnxy*yyzFz{{c{|!||}A}~~b~#G k͂0WGrׇ;iΉ3dʋ0cʍ1fΏ6n֑?zM _ɖ4 uL$h՛BdҞ@iءG&vVǥ8nRĩ7u\ЭD-u`ֲK³8%yhYѹJº;.! zpg_XQKFAǿ=ȼ:ɹ8ʷ6˶5̵5͵6ζ7ϸ9к<Ѿ?DINU\dlvۀ܊ݖޢ)߯6DScs 2F[p(@Xr4Pm8Ww)Km Adobe_CMAdobed            " ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?&13Gܓ>~I%1r[RT+Wkwn2 [m~zi)>3GܤJc>3GܤJc>3GܤJc>3GܤJc>3Gܲ,*Yawwks\V_W-:nom3ic=lg-)$g-)$g3͎e5| J6}>~I%#6 _0Z1[>z3e}\ꭱ9UeaoQo{'Zx﮽[Ӳ:g/ô]$9snll{&@e8h##}NX41#3'c}ގ&%-}^n^- C:Ӵ{?x~O)ȹ>߫'VX\EΓӪKD_Oȉ[Fߏ H Y}% mm澧ø95=MeďM@$MnArDLzn=9V_6˥ʱ_kYڴ@3:vR$f=h{skA.z~+Ycciu k.ۿ9:T6c07eղQϷ 2oLߌ]Sn쎲lSvXas^}̩kElrnZGG9^&.-`4}s=k3}[Z˲o=N ysghloT[ )I$JRI$RQw6}>~I%)xwuޣ~ǡ7YV=7^Co}[:gkWs:v{w[RbGFUuL>k1k|Pu}˿v~qUWGO ~Ycj)}Wme??K_/l_Vm*ciY nsz[=蒈Μmǿ#owE."5-s }hs\9[/2я@%6Iv-c?̹gۺjۋ1owR9Tqr2l>Ui߉w7m/ܜMd lX_j52]d,ϵ?/íAٶY;a%8xT:Sr:պunVql< |f~I%)|կt{^9^9}~_H[cXXX"wagz~խqVӐoM5޻?EcO"B=GJ ҭ2^.c///5: ӮJ+^MyC\Ӑ!Kv0w_z?,1G;.bkׇ7lgTֹܵp4БJZ3ûFUOͧX[\}_?,t["A~_jE \ٴ >Y}`Jyy6Rٝ`3*X^e6Փ{%>~cI &zhp}7 =ko潾TI%)$IJI$RI$| %?6}>~I%5}2ۻuvnjßٳג2u[ku.ǩUcַ[~em{,u^_팇Gݿ7k}Ojz~Xz5LeN7 .u'5j[~ŕG-~T7zn f7o쭞>kKϭW~w:S8`,WguQ˙פe:c8/׻}2eO7[zYK/Ʋz88N?Gcݑwյ'W&[X@a??SQ$ KYz7::|e;?{^{_cK闷nm,wؗ^վf}9PmU}&Tn~#ZM_HOi&rۘK}SYsWc-<1Â/4zFǮ8en57: /hc7 Oסt{q{2Y[7c I$Js[#\ cs6+=o-RUߒ\q\zqƒ7ocMʱ4+ۙĸUw[)**=ɫ!89csz/[cZǻc epٳC!m*/:2ۚZkV:ec5Ϟ) 6}>~I%8ZF?UXŸd]Y!N{=?Sc[8>+h8xu!罷]lήq=O}~g.[nf%=E6F.k_Yn~=7ACI:@ջ9̞+ñCuuWoEf>?k?O~7t_[Y4S^f#X}o&žKˢ[9Z2ư-"mom)l<Ey4;h{~;^?VwJï-5;XߑWVMbje,T42ֵcXߡ?@=`L?w9+c(EuV4x1֢$JRI T,&߀ W^7чPm'GxǾo o+A{huO;wⱶg<5vc}r_:Ҩ @>g Dt;Osksδ5{ϫwNT{,}⶿I[QufFMޖ5U1vm:~.=>M7KZi>_^"H~P'c:^leSkF5N]al5 Gm_Os~wVke{`'mo[vPsś*1Vk=W뉮!ޏ^ 5he[cKf=$tWh~c:~63~]{ʛ`i=w;Pv9ti֢;S㷞Y>o*6}>~I%)$IO*ߣ*F݉m@ Oakjd72,km/"VPK뵻 +澻W;::Pyv 'X-u8c_S]Yuu[XrYQK\ڍ>þEn{>%3$HMl1#]нC_Nf6d>p;lZҦ]L>JfI$*G܊)!m$C~ʞkm$Q]HtiaXh^S+딩ݎ}6ZOѯ}e:]?>'h&>Wi+d 2I}ߣiD=Wd@bս_5 w1n*Cz[E{YkJ9'Yu\]t;i{ vJ,-v-`-)Vj>eg}%(ɪX MmcRisv^T mesmv8_Toҕ 9_pޙm~mv?g{.H$쨂^7iNT~ai)?;P0{X]-?nj;KabES6}>~I%)$IM|ʰe-@$XSwoՅ}kZ}w]=C[=wc{>kpSbuXϫ&E%2+ncϪYƷ*[1]r8uDm4d4k?VJjdu,j.]o i/YVM;:܌|Muzƾwc[oog:'ϴꮺ]kL4Xln5lINUHi`{.q69fy/e&knugیcfWz_X>ڝMm0!l܍>ӏUtzhIM쮧n0X,sDUªk7sG"~I%"ɧeVigrײί֪饗;; kwWsqd_Ol?]kvlɪlKfCYe?5Œ|;.ۂ{C}<7ǫow<OXZ`Zt=yy)uiN?}#^kJމqELzvxz s[=Uo[}P_G7ѿCNꡏ$j1k;rl}W?WK5;Z1knɣ99lm9 smRQfVl7UؒJ<lXo_\I}C.et1=un4X2N5]3.Beu]ck d$I$$I)I$JRI$RQw6}͍tIOmp"2}czfQ]Vg=鬺Ѹ}nWW.}_]zm/9i#kS~}{=hRz*e4UUM ֵX1ֱFEkitΫ`KnE>˛sU[iȳdem>JÄYcmnǖ4{uA/!OgޱtQN45s6cە~6=^F:ri:˜훶67޺MT%>%>%>atK:V\mgkW2zv5pik4qOٳ~kѷޖ~Ɏ1c?keqqzr^֗;[@ZI>iwX8{<>wޖ~G?F*"Q#ߏ]z'QZXXTp}~| [LcÃD J\D~(D<'H>jPhotoshop 3.08BIMZ%GZ%GZ%GZ%GZ%Gx@a. zeigt Schattenriss von Bodo Wartke b. Bitte nennen Sie bei Abdruck: Jespen/Bauer/Rosenow; Abdruck nur gegen Namensnennung. c. Weitere Informationen zu Bodo Wartke im Pressebereich unter www.bodowartke.de d. "Swingende Notwendigkeit" ist das sechste Programm von Bodo Wartke. Mehr dazu: www.swingende-notwendigkeit.de zReimkultur GmbH & Co. KGP Illustration: Helge Jespen unterUReimkultur GmbH & Co. KG@CD Cover - Swingende Notwendigkeit Live und in Farbe - BodoWartk Bodo WartkeSwingende NotwendigkeittTBitte nennen Sie bei Abdruck: Jespen/Bauer/Rosenow; Abdruck nur gegen Namensnennung.8BIM%`Ob8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTBrother MFC-7460DN PrinterprintProofSetupObjc Proof Setup proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM x8BIM8BIM 8BIM 8BIM https://www.bodowartke.de/presse8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM@@8BIM8BIMnullbaseNameTEXTUserboundsObjcRct1Top longLeftlongBtomlong@Rghtlong@slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong@Rghtlong@urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM 8BIM &,% XICC_PROFILE HLinomntrRGB XYZ  1acspMSFTIEC sRGB-HP cprtP3desclwtptbkptrXYZgXYZ,bXYZ@dmndTpdmddvuedLview$lumimeas $tech0 rTRC< gTRC< bTRC< textCopyright (c) 1998 Hewlett-Packard CompanydescsRGB IEC61966-2.1sRGB IEC61966-2.1XYZ QXYZ XYZ o8XYZ bXYZ $descIEC http://www.iec.chIEC http://www.iec.chdesc.IEC 61966-2.1 Default RGB colour space - sRGB.IEC 61966-2.1 Default RGB colour space - sRGBdesc,Reference Viewing Condition in IEC61966-2.1,Reference Viewing Condition in IEC61966-2.1view_. \XYZ L VPWmeassig CRT curv #(-27;@EJOTY^chmrw| %+28>ELRY`gnu| &/8AKT]gqz !-8COZfr~ -;HUcq~ +:IXgw'7HYj{+=Oat 2FZn  % : O d y  ' = T j " 9 Q i  * C \ u & @ Z t .Id %A^z &Ca~1Om&Ed#Cc'Ij4Vx&IlAe@e Ek*Qw;c*R{Gp@j>i  A l !!H!u!!!"'"U"""# #8#f###$$M$|$$% %8%h%%%&'&W&&&''I'z''( (?(q(())8)k))**5*h**++6+i++,,9,n,,- -A-v--..L.../$/Z///050l0011J1112*2c223 3F3334+4e4455M555676r667$7`7788P8899B999:6:t::;-;k;;<' >`>>?!?a??@#@d@@A)AjAAB0BrBBC:C}CDDGDDEEUEEF"FgFFG5G{GHHKHHIIcIIJ7J}JK KSKKL*LrLMMJMMN%NnNOOIOOP'PqPQQPQQR1R|RSS_SSTBTTU(UuUVV\VVWDWWX/X}XYYiYZZVZZ[E[[\5\\]']x]^^l^__a_``W``aOaabIbbcCccd@dde=eef=ffg=ggh?hhiCiijHjjkOkklWlmm`mnnknooxop+ppq:qqrKrss]sttptu(uuv>vvwVwxxnxy*yyzFz{{c{|!||}A}~~b~#G k͂0WGrׇ;iΉ3dʋ0cʍ1fΏ6n֑?zM _ɖ4 uL$h՛BdҞ@iءG&vVǥ8nRĩ7u\ЭD-u`ֲK³8%yhYѹJº;.! zpg_XQKFAǿ=ȼ:ɹ8ʷ6˶5̵5͵6ζ7ϸ9к<Ѿ?DINU\dlvۀ܊ݖޢ)߯6DScs 2F[p(@Xr4Pm8Ww)Km Adobe_CMAdobed            " ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?&13Gܓ>~I%1r[RT+Wkwn2 [m~zi)>3GܤJc>3GܤJc>3GܤJc>3GܤJc>3Gܲ,*Yawwks\V_W-:nom3ic=lg-)$g-)$g3͎e5| J6}>~I%#6 _0Z1[>z3e}\ꭱ9UeaoQo{'Zx﮽[Ӳ:g/ô]$9snll{&@e8h##}NX41#3'c}ގ&%-}^n^- C:Ӵ{?x~O)ȹ>߫'VX\EΓӪKD_Oȉ[Fߏ H Y}% mm澧ø95=MeďM@$MnArDLzn=9V_6˥ʱ_kYڴ@3:vR$f=h{skA.z~+Ycciu k.ۿ9:T6c07eղQϷ 2oLߌ]Sn쎲lSvXas^}̩kElrnZGG9^&.-`4}s=k3}[Z˲o=N ysghloT[ )I$JRI$RQw6}>~I%)xwuޣ~ǡ7YV=7^Co}[:gkWs:v{w[RbGFUuL>k1k|Pu}˿v~qUWGO ~Ycj)}Wme??K_/l_Vm*ciY nsz[=蒈Μmǿ#owE."5-s }hs\9[/2я@%6Iv-c?̹gۺjۋ1owR9Tqr2l>Ui߉w7m/ܜMd lX_j52]d,ϵ?/íAٶY;a%8xT:Sr:պunVql< |f~I%)|կt{^9^9}~_H[cXXX"wagz~խqVӐoM5޻?EcO"B=GJ ҭ2^.c///5: ӮJ+^MyC\Ӑ!Kv0w_z?,1G;.bkׇ7lgTֹܵp4БJZ3ûFUOͧX[\}_?,t["A~_jE \ٴ >Y}`Jyy6Rٝ`3*X^e6Փ{%>~cI &zhp}7 =ko潾TI%)$IJI$RI$| %?6}>~I%5}2ۻuvnjßٳג2u[ku.ǩUcַ[~em{,u^_팇Gݿ7k}Ojz~Xz5LeN7 .u'5j[~ŕG-~T7zn f7o쭞>kKϭW~w:S8`,WguQ˙פe:c8/׻}2eO7[zYK/Ʋz88N?Gcݑwյ'W&[X@a??SQ$ KYz7::|e;?{^{_cK闷nm,wؗ^վf}9PmU}&Tn~#ZM_HOi&rۘK}SYsWc-<1Â/4zFǮ8en57: /hc7 Oסt{q{2Y[7c I$Js[#\ cs6+=o-RUߒ\q\zqƒ7ocMʱ4+ۙĸUw[)**=ɫ!89csz/[cZǻc epٳC!m*/:2ۚZkV:ec5Ϟ) 6}>~I%8ZF?UXŸd]Y!N{=?Sc[8>+h8xu!罷]lήq=O}~g.[nf%=E6F.k_Yn~=7ACI:@ջ9̞+ñCuuWoEf>?k?O~7t_[Y4S^f#X}o&žKˢ[9Z2ư-"mom)l<Ey4;h{~;^?VwJï-5;XߑWVMbje,T42ֵcXߡ?@=`L?w9+c(EuV4x1֢$JRI T,&߀ W^7чPm'GxǾo o+A{huO;wⱶg<5vc}r_:Ҩ @>g Dt;Osksδ5{ϫwNT{,}⶿I[QufFMޖ5U1vm:~.=>M7KZi>_^"H~P'c:^leSkF5N]al5 Gm_Os~wVke{`'mo[vPsś*1Vk=W뉮!ޏ^ 5he[cKf=$tWh~c:~63~]{ʛ`i=w;Pv9ti֢;S㷞Y>o*6}>~I%)$IO*ߣ*F݉m@ Oakjd72,km/"VPK뵻 +澻W;::Pyv 'X-u8c_S]Yuu[XrYQK\ڍ>þEn{>%3$HMl1#]нC_Nf6d>p;lZҦ]L>JfI$*G܊)!m$C~ʞkm$Q]HtiaXh^S+딩ݎ}6ZOѯ}e:]?>'h&>Wi+d 2I}ߣiD=Wd@bս_5 w1n*Cz[E{YkJ9'Yu\]t;i{ vJ,-v-`-)Vj>eg}%(ɪX MmcRisv^T mesmv8_Toҕ 9_pޙm~mv?g{.H$쨂^7iNT~ai)?;P0{X]-?nj;KabES6}>~I%)$IM|ʰe-@$XSwoՅ}kZ}w]=C[=wc{>kpSbuXϫ&E%2+ncϪYƷ*[1]r8uDm4d4k?VJjdu,j.]o i/YVM;:܌|Muzƾwc[oog:'ϴꮺ]kL4Xln5lINUHi`{.q69fy/e&knugیcfWz_X>ڝMm0!l܍>ӏUtzhIM쮧n0X,sDUªk7sG"~I%"ɧeVigrײί֪饗;; kwWsqd_Ol?]kvlɪlKfCYe?5Œ|;.ۂ{C}<7ǫow<OXZ`Zt=yy)uiN?}#^kJމqELzvxz s[=Uo[}P_G7ѿCNꡏ$j1k;rl}W?WK5;Z1knɣ99lm9 smRQfVl7UؒJ<lXo_\I}C.et1=un4X2N5]3.Beu]ck d$I$$I)I$JRI$RQw6}͍tIOmp"2}czfQ]Vg=鬺Ѹ}nWW.}_]zm/9i#kS~}{=hRz*e4UUM ֵX1ֱFEkitΫ`KnE>˛sU[iȳdem>JÄYcmnǖ4{uA/!OgޱtQN45s6cە~6=^F:ri:˜훶67޺MT%>%>%>atK:V\mgkW2zv5pik4qOٳ~kѷޖ~Ɏ1c?keqqzr^֗;[@ZI>iwX8{<>wޖ~G?F*"Q#ߏ]z'QZXXTp}~| [LcÃD J\D~(D<'H8BIM!UAdobe PhotoshopAdobe Photoshop CS68BIMmoptPTargetSettings MttCObjc NativeQuadBl longGrn longRd longOptmboolQltylongP blurAmountdoubembedICCProfilebool fileFormatenum FileFormatJPEG noMatteColorbool progressivebool zonedQualityObjc ZonedInfo channelIDlong emphasizeTextboolemphasizeVectorsboolfloorlong8BIMmsetnullHTMLBackgroundSettingsObjcnullBackgroundColorBluelongBackgroundColorGreenlongBackgroundColorRedlongBackgroundColorStatelongBackgroundImagePathTEXTUseImageAsBackgroundbool HTMLSettingsObjcnullAlwaysAddAltAttributebool AttributeCaselong CloseAllTagsboolEncodinglongFileSavingSettingsObjcnull CopyBackgroundboolDuplicateFileNameBehaviorlongHtmlFileNameComponentsVlLslonglonglonglonglonglongImageSubfolderNameTEXTimagesNameCompatibilityObjcnull NameCompatMacboolNameCompatUNIXboolNameCompatWindowsboolOutputMultipleFilesboolSavingFileNameComponentsVlLs longlonglonglonglonglonglonglonglongSliceFileNameComponentsVlLslonglonglonglonglonglongUseImageSubfolderboolUseLongExtensionsboolGoLiveCompatibleboolImageMapLocationlong ImageMapTypelongIncludeCommentsboolIncludeZeroMarginsboolIndentlong LineEndingslong OutputXHTMLboolQuoteAllAttributesboolSpacersEmptyCellslongSpacersHorizontallongSpacersVerticallong StylesFormatlong TDWidthHeightlongTagCaselongUseCSSboolUseLongHTMLExtensionboolMetadataOutputSettingsObjcnull AddCustomIRboolAddEXIFboolAddXMPboolAddXMPSourceFileURIbool ColorPolicylongMetadataPolicylongWriteMinimalXMPboolWriteXMPToSidecarFilesboolVersionlong8BIMms4w8BIMhttp://ns.adobe.com/xap/1.0/ CD Cover - Swingende Notwendigkeit Live und in Farbe - BodoWartke - quadratisches Format - CMYK Illustration: Helge Jespen unter Verwendung eines Fotos vonHarald Bauer Gesamtgrafik: Bettina Rosenow a. zeigt Schattenriss von Bodo Wartke b. Bitte nennen Sie bei Abdruck: Jespen/Bauer/Rosenow; Abdruck nur gegen Namensnennung. c. Weitere Informationen zu Bodo Wartke im Pressebereich unter www.bodowartke.de d. "Swingende Notwendigkeit" ist das sechste Programm von Bodo Wartke. Mehr dazu: www.swingende-notwendigkeit.de Bodo Wartke Swingende Notwendigkeit Bitte nennen Sie bei Abdruck: Jespen/Bauer/Rosenow; Abdruck nur gegen Namensnennung. adobe:docid:photoshop:d1781f86-624a-11e7-9fde-92fb9f9c5921 xmp.id:bd476abf-53bc-49e5-a3dd-46b2e159c3d4 ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^gwf˷>9T~5wy'o<~G{E@^WVڹq*+K_Ap㇍̟6O֛_p}RfGrH麖nNl-]bUHȷܓG#uO~t8e1Ѓ'y;EY#sؓYB _<rOɲ~l>dу'y;EY#sؓYB _<rOɲ~l>d҃'y;EY#sؓYB _<rOɲ~l>dӃ'y;EY#sؓYB _<rOɲ~l>dԃ'y;EY#sؓYB _<rOɲ~l>dՃ'y;EY#sؓYB _<rOɲ~l>dփ'y;EY#sؓYB _<rOɲ~l>d׃'y;EY#sؓYB _<rOɲ~l>dЃ'y;EY#sؓYB _<rOɲ~l>dу'y;EY#sؓYB d;5 sjrk98KǸ5O#v$LH+5:+Nk(fdW;.-LIc׵L+ Lfߪœ&{{}v%EoѴEJx ]'ennn&U%mI%fRZayvIRSWᱥǛybҗz k&rIt3t3Nsư3=)`i[OF,1^)c dN1}Lz.jlK2,P+uVړ4Td/Ru^ph];zw%r^[WRě}ZFRNN1哗i~VrZwm sZv6NfQrC.Q'5ĨsBc8nJ,MLKh(ɌDʨb9k~O~M-􍿕dq?/$҃'y;EY#sؓYB 3Pjy#QkvE㉋ \"dmï]c9&i)-4XXt]$\Yruy5ga bT10^SP2F._n\B{8g8l:&=q# WlKd3q^ bJWj+]i/wJΓISr q~hvuӗ1m,HMvNN~eּRj):Qd?o7r/i>WEv&B_I^<޲x};vY%mL9 i jmtq(ʤM%FrGfv}\:xslhߤm#~Y#Ӄ'y;EY#sؓYB ;_mG(I 6XÑ+bE'-k)TfQBY\"j6Ja ۘ|vv ֚w`owS3[c73-'$A쪯2[FUHmEْ~xϳ.N-K̕a{N42X¹!P5xQN1R\bU.ϕ 7vhxhug{l=?n5tFq-u.VrOT~y$qvz%Y-pUUIծqkw'|JrۍyU^2\9*p. N߼5aS3Eþk,y*4 O.q`ȍmGg /W1?sw?&˖F8_?ԃ'y;EY#sؓYB =^c9w^c+vJaWCdKqD^"$ʝ8e%A9JM$_fD1q`rJ1]Ku<:l=.EgnKcǩb*}Ž%Xa-ZHKS;ӏę3*6Ox0q//c{{њk%\"==g ̼%zKt5ǚ. HRJW텾)65̼u~N6ɑ 6Pv~Ka$ůJ/rVt&ʹj.hM"ZQ!$ }\:xslhߤm#~Y#Ճ'y;EY#sؓYB g5x'4nDBێGǩ i UJ0ٗ,G巵*8K#J!B<_piA7))'Âo:Kan|)c&,Ty::6iI283cII9]KmMDβT2IJd:O#>T1F|=}r ~+$aeW^5ŀϔMy^uKѴ}MbK1JtO'V*׵|{W|km*ז+c^XWŲJ@ro8| [D!s4WU\ٽ.ZG"+c\I%UE5<6vsLX5В}Te)kQRFfDQ\I6\[o.ݫ+v):$mؒ\[~-+hlRAimmi.=}eUe|uKcc>Z 0:IFDFc7K#zGt}] WIfe~`ZmhKȭ ڠ<2;:|ͯ\{%zW;|$h5Ƕinʎۋ3i.f{rxcU>Vs ݑvՏ݀p۳ W.6o#8e 4f۳Wj:SJ {w7*75M(]GR^i?>7~ ׇ++đtW-kWTW/1?KT0;w3nf jTNO!X7 FHv+33n$//R;0-sc3ECxn(S*֪1Pl96TX2oPtdkW4kF{J'rMsI\|Væxb wӍ֒mͪ(^n2o0Z_ r/r96{%Mm)"ve ,D^fl'['e|t:!LYZͱ$pmdt/m]͌Oɏb/DŽ99aq)\♟"|j8.(ZPlVlc-;#\cƒfqI{D8]S|K.2c\ȾI|)Zps3,%^}vuAdlJŒb9k~O~M-􍿕dq?/$׃'y;EY#sؓYB ?㗙G8s&SwScQ&su5>wuQUS"\6vSmĒoE[nކ=;Qۡ7؝ SGDZ+iŬK *AlYInQ> {x}Ys9N>IR>n1Coʴy)ClڼGچ_P/#&g_i+]0125;NSjE4Z>) N4sys!A~!k- ~uNvi*퉴o៽Rkgq1\eK}mS8|߼lZ,(2m=y`iV>f`.&jz?Q;ԝ1^ L&\OA0xTx.3[H۞Ϳg62#&HQu'%LyחkqF}E W݇ߌz;z\ekmi-F^ rF|"'C)$#/AU:]YmA:qL%'DCsz&\"GzޫYIYɻ x\S{-r'nrmM+w&^k{'ZOش:&R;<nhr8J4Do}VěE: }ݹ^\)x6Kߺ9).\kȡW]ʼwg*md͖.\5-_(ycrX6%RBPg* sOj毮}zRUX-ﻥZͳL⋊IDG%((Wy:rY i0L.5vtrKXM6T}mmW<`c.&~R븩-K& zHjnTgo*F1MF:z)PATGEfbl[l\3ϭP<*l Lp^"WBkhFWtRHffO2r&˧p<]Sf'6QG:dJsɐFXdrH33 U:me]7#eѻ"|in ˦EAs|{(ŗgFmĬ=߭2sqsjr{+K0,j&_.I:69|Tk\{߭hFqFw Y6uxҗcq˒ɨMdj$>k+ ]ŕvx#p\{c6RWUbƄRF$e/θysssns]rӋr$iR04RvڢQ}XrVQI$dNʸm 2}ryzrLvǬ%Ŷi][&#%4#xmL^vV5ĝD{eX'KʌM{r^%޴%q;8 :$C2ǦN#yw~RyDlm-fV~c/Oiכk->x:Yq6S[µIM'Zo˕tnƚAҞ׶vOsn3:x#,Y_i^=UW1Kn;BIfMɶ) R*Sgֹkuj):=1Y}9R1/INVJNR5GƼqNYc=f؃SX hu23]^VURݒPnDmj]"Gh V4o͓u_M}]yFjSoВrliv"{;dn8~Ai7 Mτt(<5/$mwW!%(jwkUkVL²KIN"İ\m>m%X#JYnU\“Ezl\t W1?sw?&˖F8_?Ѓ'y;EY#sؓYB kq{w/ӷK1þ:dcAհzk2B߬sP$d0ޠjl߅d؅;[3Oܶ?u *F۫rPbf D]hכҧ ~Rv#dcZ+R,8%Rj>2R褨c\S9CNEccof}Y gtXCIO DgKtt'N6s_#kY9%˒p^N\| "1_8.8Gn4m1 Btiۊq7Oȉy%F!kZ \|m^ V֠sfv{#{ThÒM?HSUryW9_E;K-s qo7}rfSYhfu` ;ȑ_xW_yzcwny7|4;(F0y+u!lƢ)^Jvaj-3Pܘz~TEVa4S.mf/diNmǚ/W|4c&U0S"/1mG1J1^TFdwJI:.Wܻb=P5ִZڣuLJ3ƩZ*HfJ#M{tE;Vn߸Xhm*%U;%M m/m+3o[N]&JD(vd!לmJ#RԔD¢l{*kl"8OD]%SbDi'cLt3/2F9}jj%ӣ^G,:4yd z4[#J<䇝}uj[(ֵ&gIH^""b9k~O~M-􍿕dq?/$у'y;EY#sؓYB 8qv_'67+WZJzLYʫrj8[:WR b.3}q#$es©M~/z]%dI\ʗmURW.>XGCxz5of·44SaG jri+rեɎZ%N:m$4$^O qMŕ#zXVZe}ŋl-Bv V[~Kl&]j-fڷ.K7r]|+׺.UNd^<0RZr5MST]~*]ȬړַȠۋlK܌]k k#eܸvRk'"ᆚ'%q)vC2'px"KamIuvQYkWcpjFIa}hR23ns5rqZi 55F]o"ܭ]Uj+ĀgA ƪ–ު¾S.(7iKyO=%Ǚ S,ʊۭiI?F- +\u2'\^꼏(qY{!m,i)l8fnnn]RIG$]+N?.vbfrn0ʟTڋUhk/,z]bEILKfX=dP.b-_HU(ӎ- ><'k47"2 GlLeCZ;^̫zm3?q8iIG)bE'ž5 .%rm.Z[NW95ϕ'sO]Uj1<:ؖԑs|Ue PK=E+jekq x$qxgٕs^ZzHk[mZbtȡ_t) ]mK?_Ⱦ6o2Ji^oV=~oLt,+1Wg5' 6k܎Ńi.HqI*Y~BeH:/)+5Vɾk-G1T};漛IʲR؉iܟZRں*xɾV/m?@w8Uc wZv4r-1ſ/"J+Tc(Mq&,Yع GP_8Jk*V-ueʷT핫/Wr[BYcQbiSx0L n:1l]~qKL23`i6.E}\:xslhߤm#~Y#҃'y;EY#sؓYB q;d^\DnRn*+]g"ڥiKY&#i$NmiJ`ffX;%>1f Ͳ)[:$10%Jpj-8} )dFw-[lec[UcCǚi4Lӧڪ7f-伶|!WܕFEǁ\hWl~Pv#nmu^8O̴ݣ;Hm=aK<3SB!ĸ%2zm6-ÐMe(Iu5yQWJv5:Ū׺kN'3?4HhކKqhi%!2qfIJ<5"3@c'EU~REKDX.R>ks05dg5}ǒuK~\!cD3|>#| qRJf9eUyY쬞Z' ^(GetAYzܱ3+_#x^Xq)%hF<N+:ę )eB!$Q_ߚ6hx\ѓ.U*E%N_ xD+]>u=\ӟIp|.UrjXϏ. 3L,qTPdz>4Qp]gJZ^?0Ԩ9˟uO% SI>ٰwkv|iW#=S5mu6ʪ'w6o2ή]=Y Fɷgp&nϔq]UmIR|R|SUd#n`xV~u=_:?[&J>1ML޺_wܫyøÆn-Rlxmmm|Z;;Ff2$JrJd9>*Xe"%%jb9k~O~M-􍿕dq?/$Ӄ'y;EY#sؓYB VtFVwS!{;i`(.-̆RcNu*[ Fca9v3KƖ~|cc!kiiZ- JҤ)'JФN(ȔFu##221ͧcq+ EmFׅJb, Ċhf.}յb]ȝ'"K&/N6=c7 R >OUE~!I*N~u8'e*׌7*:u.Qi12d)du$:}ןy՛JRԥ(ϩ莛m[f|mCM! I ʔ!)DDEЈHߔQ42]mmo<,iZlJZd$ff} I$Q{u֣8,uViq\_BJRDffgЈgˇq͍K"Gk5 JcolKmS=+$MEƮ#,Z֭zf۴ UH&kkQtICؗ.j;pG.frJspt U^bw=upg~wQBiO-ѷƩRa(<b3g+xg]wNgz!kh2y\;;=_Rn䝔[o>#F7I:Fz[%zJ ǒ-pH#U)Ŵ51˙fܡ^y$ۗ>[ɸ}ٓiYw:uuM"aKcuf\HYKL Ʊ*\{fX١$d:ǐMW4_vE^<r.DYUH3SRd4ߒh2(P-ZqƟ&rQmڴ*/9o& {S_Oѱ//_(sF/DcD3k;x5yt}+).|W11W-_f:*Zdsuq/Z?eZb%+x?䟹;eF#o|} ԃ'y;EY#sؓYB v\!ə?v έٜeŐZZ\вL,E^X62<Xw{ؽ,m;5.u>7Wdk;R~s.[ؼuWu ջSM,/SF_GJ)٪M5}3Rjwym'*.>g,iYI5\#wsK?w^0r;x/+Ii:bzW>_]S621MGE^4Йeq~k2ykr_ldoYW'nˊ/L׺98xvczC*I8!×|6'iЅۍ/ zҜU)6WJku.SO+qo'.|$bI0|@aڿAUYUPS8~r͇2c }%WJoȤ m6mfoǼ^O6(k.2oqgL Aƛ:dz1p$N*mEqII{V#ErQn-ڌ\d]'z$\Ygx<Ȱf#>²$T%iQ6RP]kqTopQks*x|:{8evt{ ݕ'8i.bꮵtGѮNb6es4OY/B:jg:m p^j5yRM֕tghnNb8_=qcl1"\U\e&cGuxi5D:Yr@_<rOɲ~l>dՃ'y;EY#sؓYB q;cq-+c9 S.$̔]TRL:?̏JJ]9VI|OlGXLDiԄ%.+JӨCQt2#H}cn(pvo,Nv|90mXC[z(BcBlXv18%%^fjҧ&myz$Z4]JPq LcÁe<.*Uǻ275=Sjۢ%uivna!O߀N5 ߇.r@F sG^}Qu$՛l"-F\->OeͶ {X1诈Gl7r%3t%֕Yн~U:=`>#7:pgIZwz;:7ǡrUF~ V__+2}eJOo'iDZjcE\p`{b=>Vm>Rz񿐺P=>nW ?B|(YErv"q:<+ƛ$֯6MCU$|^11JMUG*\s*KͷZG(G̊~[wwwo@H NCY7[jYzZ`ZB])JIRFkin4km֦ևh[kAT^$d~G82P J*JII222pѺ6qEzamҡQIr$嵘Hqr'5Tz"y0a  '7.f{\46;nw(eF5^UڢHw&4M6#l91gkP6T9[ð96ХɁWg~[eFeCdxw,Ͷako_9Ygjwwfmd-V~&~TJHԣ$|_g̲r$*RtIx"66FeBW.M1mHYuk,?#*|yeM*ڢrmֲCŴm(yl =:J2M vVԆ$!6|gȄHBmaXV6cE z)NٯRvN=i%$j-(DD± Kp-aKu=X,Ψ4 SO4TNnyj37c3Ca9/0˝އYAPX`cUֻF\3meZvҢ ysړ+DEez'2v.)؍SjUj&N[˗voay1i%( )/UqN`lͻȳ1b Ȫ3Lz#̣Y&n?^RWe6":q]m3U9˶vil*-˲KWI+܋ 坽RIO}\qDKDDE+XgqnQWbTIz!ܛyRsvNRr~[N)S^Tc%ӲQj1vZjh6eʒf~#W1?sw?&˖F8_?փ'y;EY#sؓYB  K**ulnD r!̇*#cU%F}nS䗖DvI%H$/"ˢd~^^rߛڛUl֚KD7s.J^.'"S.(jdfBߑh|rqm\uen ƴ~K,^_l|ɸ1můCLmn(mvov׷"ܐmݙsrF~Y(Y8d2#gե/0|3f%Aw_ư Ak$ؙͦviLؕ %?ɧPm-#-&rk9k\Tqb](e#pojVQqR#]I(r$eZAV!~?zۭ"5),N~P.Ww&|#r}kEsfլ궓w!ؼR䔼U'mJK)Ji͓ww"hO.]ݍ+v/VUêQ@, 43m)4m8)?]? 93}ÞVKfoֆg&åsRCN[[v׭.FvgLwۜشa/$mSXb䕹zܯNN3QRQں>׹\wY)ll/U_p]Ev!$ٿM^FgM[oC :Pk.DMgc yěA%;qJIJUN.wЫjW 8BIU} /"\㳯iX?EE* kjZKռ~Jc!I\2i25#!G%#T]Wv>Xx^C6soqXK_4:%OWdIyHeqNN><ۂ'Dvwq;XxyZL10&.UmSΑ׹nۙ; M+ ˳<Ɋ**iLɒ ԥZeu!UNeyӹq7X@dUx-M0㵭C})W6[Y[v.7 ']WMsiw[r&f]nn+ݣ{יpv65TC̲m=bhd$^L[ saYI$0^j+]q2 ̀o!̲ f^mJmԇ[RZTr.MxeNĥ.Ɵ]&f&FU<\d+4S\i%!vf 5MYk͋fnQLVcБ>|u)>fD֔q)ZT;6Bg|{Kߵ u67j<f c; 2n%w&~Uuaxc y׸Z)%/'pY-癚 9l ;舩.!55)IKA616WbdЃ'y;EY#sؓYB 1KIsAǪl$"%m5, V2/@yt>mgEQo^n1s$mqT5n.+\ [Y`Fo'KRiYkQz_a䆪&>i%.̧GM29?U"my\˜5*4sh˗*[G[~>'ay]í_YFGڨ,O2@N ir AaekwfCr߻- ÜFw5G }wn8 5u5EAklx~u.Jڎʐㄣk_V-6Z%dd\-ݜ9VhJ} j}B։yXn"x*&Ni(*j8qZGE_r?yZ~3}5mf}5>,@pXaJaO4iJφ-po3RMO::ƵN_TQd(ZQGJ:xtO)8Cto:OXMe:R\x}vħ+rc6ľnu{ 7&7xxeqI6f3]4IFh݌J:c+`vVT9R?>Nd&J E|'/Ĕc*S̳7J]iV`2v\*n>q Ͼm_dw6rP)>~Ѻ-ۗ"S%>'ZII?ky!aU[-b-$}[&YJEWjJIQf.Lr%4̮--7Z[@+oE\8d(˯s؎ W^khIf'dQæe:u2._Iv8xɤv12۝xB.OIc("L*R,Q{WC\OIQ;'6֚ddȺN7GL#w#:+~ -ĞI,4GjJTC[WOs!7nu8N.wrÕ*um/>-XS&̲'ܱܗ}m45:HhuMշIfeו .ܼHQVw&ID)lVORIԓ>. XVF,>]j+1kDeΓ2U崫5kaC긏\5ʳ;߹ ={Bd'ԙ0VedJL1NPMㆮK] ke?c(fFtSMJ2m(EZ7$n..V l2m&M4unK֛~H)Ԍ7sU+K5Zve* f6✋h$ϮɒWKRoX0Eh+mIZrG$X%u(歍DVBHUTu2(f$-y|b~a5?4U;v 6.5tlNE~=bag5x̤r\m%8m*QP,둵n RtK/\[ฝ K&8xۓ~}.I.-S-ù5^^y1W"(6*A<~g^pț4n8ۋqD|; Ũu (9`\D3]7ګQdto(2{;NХcv]`@,tؒLn=qm^S9FI3,/ɲlI/kqoa!^.=&C<ҥիxfTaI*$ pD#~쬉I9JORo۩2g1*+[ ê7WMO[$54veDIBI%C΀r!.$h[0l39$gO[d `O4$9Ur$r_TBYwZ5"ֹҮk%I*ӵUw\>msF Q>K֍SJj/~q'7cݏkk^!(FCs-ګcCᶟ2'˳LVw2,=giռx"ocW㕮^ɩ nW4Μ>t`(r.tf<%ǩF޷vi sQ Vl^jus\{߶-gKp,cd~VL3+ !~2Z,ՙJZțf^TZJV/CSax]dZ1V?`Sն/mԣgr`ޒcŹ4^- zYl^ɻsbm$vy.QXYTx-A ;ܗ'CG/4 {Wyĥ>!-ٿ FIqc-I([*N,dYFyW 8eMJqs#J^~pꝛ X;o8yR/ԋ^oRLwI/drj{v%W4NW$Ӄ_t]AۊMne!+ęCfsԘݢkiMCuLƓdDI/v.)*}uykչ(U N_J1R=;Ff/?,5ɚmh݄٩:3,i=>Ql-$8hlI.XrTXƶگk'r^= :Ey{וVW݉:lxi猷 TJRLddF)ַVJZ֥)kRJZ~e-jWx6Bm BBI(B]| /w& knw *-mTh1"ėN0>C"U%__޶^+tvJ lˇwko)UvNK7)Wh*$H.?Du27IGHzz:}ny5>|eƛ) %áxv\.𸔗U_8t&VlkKJ _^B-M&YD`$y^=KEI>LHCGkY96'Y(K2iPz[N;&7wRbM\ӌs Z}̸GCലŶ >$f:Q/Ookɬ'Gz< krn嵝~)w+KKMF ӾV'6\!nyFŨYqO3Y[# Ŀe9T}L#:x k+7z.-^cM]fUqh$PD. }nت}:B{{FnD;w\|nowe ֲ"F;"SYǔYQG2~=*'-)J67*?Rb΄^ok&6K-7~*wU8b$. |}z̳]S$x"?퓐ǖud>O6g]%mNHd6jnf#sBp D~UTn-O_= 3B.,.M^7-y!=˫DDm%jBUta:y7#Kmc).KoAUvkj;v &eVז9]TH7ؓd̼O W'G22^8gМ~iEpקU4wHyvߍG sr_RG8\rx^4k%]|Je&. sBl]`_7'J>-8Adp;duk"u^!Q=z US2irT~ѓ^|ϧ+$c'_I:7n7}Tc54>d=|]ܭJu=f=E $:;}>$]}"qOCPiY'LC[@c!0&n ^Gz-wzê7[vu)_.:!z~<ܟ-,m2C;VQ̬0C34ң)Gq|8c'-NyYy]hңu4Zb2YuN'tuGv]Zw.}%Fnww< E?o&LH*\B7=iV!e=?eU-饴8v]QS_^kwW;V.=:".5M9lz %3m2#qM gDbÓ7^[nu脹ޥd[i`Mf׸䜾}%g{HNYCTGܫr:iX\%M̄u HQ^tOY]T/icGZ+n{$Ln>^OzR.Cyu>Ef~Ow~:35#N}1Ztu2KmS>`ȚfWQI)32V؝?iz[KlԵ+Hy:[l]MUĪz?DMl`qyoYqif۪ɋU6ْ$櫤&ùq՗)32kr]y³PǘlNocUy^dܒ|RKrݏ;%ؑ;gmUyk(2ɶDO%(X[mɎO))ݓmϷfx&Bnuwء29)K)(3?k5){n.y֠~[⠽]19hl㹯_xxD׸UY0cZG.&Bqis ވFPJkY4M@|y6vv(:>W\a_Z|> Q"\RݐݒQh|41ӓ픟{aQ. ׸75):'1k1dx?½+^=buh]a(''RMMЅԱv'i{׉w|^V\œ4Fc9q%GQCjuND, A=UО gRW SR6:= )7v}/'!Cϓz:;,pS9y Psu@mqSrm3f)dF lY{ΕUlג~^a:pcJȳ\ǎo22 <27VyjF؎T",Uܺj>+IG:*VIS^2[$M/im̜XB97Jm*֑*T\M\>y̜o /ga8 &?C~5.%?((9"T{"qt<<ԨΌȎ%1%"mZ}5p+߱%oThA`Dĩ^oVΡ Xrwʋ#ުoiRiEIvۍhߢUTkRRl|<]#snfόZ ,D\R)q2SJI/%D[{(%cKjX+x?䟹;eF#o|} ҃'y;EY#sؓYB z\~e?Ŋdԙ6JR'b9}5ݸqw_,Ǿf]Wpnj_s(?8}wl1f3Ǭ?kWf;ܘ^Aa5ruC+x896T%^ {1,`C*>h%Kj3__%u%PXoMɎڽ}SmJ&M6d9gX}ar9WB۽u7R :IoXq{OnVp$p{C#!rqeq;akby\rkOS?H~_S^dXÊ"=Yp3*faa鞤eJؾȼLt!Y=O0rR~uiU}<{Sv1~I?: z5:y&1E}&=W>Bə9KF^Qt/ZTD>9R_:W>+%6OE%}y}e#(cGP?iH zt>[抧oʟ. z=>~>:S'5_Sޔ-gm pm*Z4S:,'2fV%R2/1dXD%Y7VvYEIW!.F+Z"Q$u1^>FL{rtb&u/jx~zTuOÅNW2ݏ9ds2%oM[||;K>};o,gٶT6taS }>f~Ifj[Dn0~+ +Eռhs4e;*(J|js8Vs&ݳ`^ML\}ͨ?sTKދG[!XڂO\KP~ᙝnp',B/mgzӎ{$YBA*b󥧒jJaK}D}ͷYMLs䣒+ƬS [imzvwBV-"i7ں}'+"kW,>sOwj|ЅN⻻))Sqֺ8/!rh++Ay%YE.k84pǛ%Z|y)ͱA>Ȗ*emKGcXo,ZʸQ4m!R̔ZcNptXiջp]キoڦkYn;$odSuWrkum Ǝ0hkF^Q}s`6JVy>Ss *j̲돺dDR߇x^՜ɑ^o2LudVZ:[tqJj#b2l{u_Яzs[~IVקw BO.MUmBJ3xf;;p>83hdѧ:=ˁhuKln\S1JWOt!&FJ߄M"%\ϯvk(|9 bTuN$PQzF܌ݹ*I:4S\7fߴZpt*ڪyJȏbNn;w Z%6t*E|*ݎK.jI yw=nۙ9!wmVղyp%4Lޕp'JYKirͬ(rƊrY/7ܗ4Z.kYw!';s~ \K9n+K-t/%{}j+Nc%M :va>T)7ƣ.;vFԕ-&꣡h.R1ȼ^z&\"ezg.M~)Ct[`V^ֹ=[Eg฽ՊZ?hEuOnb9Gw'pݍbI?q`FG ۚLaX*B)rN:峨䤻|M+' ̯|\.0Qhe*K.]gQSWREB8|sۀ!|G(m}$I'znu3]Jn >9Z\q1+e_L-ʾ`Zc9.ן:ćW&teC2?Cl~!qxđC{WixLZ2$,Jrmusz~=j?|4jkt_%_Lk7mJld+/JZ^.歙IkWx/cY?}Ao]r?rW"ÃE;ʥ8=ܯ9g§ۖ T` Vv&ZN6_fڡfԓ#WI*ouF?{JWMw#s,Kyo+1*?43e]0Ł3B!d<QPg !4j^9mS WU'y43_c_j"Lt+ߊcIcs;:~fF?kk;z39RݸZ8w:?mb7,2z^FYТRZ,]m.[Y,F#"5V_E6GTGٺT(ꎿ)vҶ=?}r\?Ygm\m .Jk|2}G]כ`&{M6|}gY6\\9m譵OEK}{\IE? `qk?(g**$djKrWkkQx 6yef~qbM-Xf5M5F!n}#Q&g81f|"_feK.R l)a8~/V9!nWbN;R %"J2f^T3C \cc=C}k%1*(JY-}l8Cf sWۢKj1s%oЗqw4\ֶ̂3'EuvT CL%Izgo>y hQqK[X!%{S ɐhi]KRgjjW_)קUԝ<]?M '@VZk4taG3{~Z$V/*WIb_n SED_dG;=ޞO Sp簧o&NCs?m^%7h6,ZpmkTKظD\)B?hF" o;Vr5e|ouF~^yn߇ү/I$F+M 9ӭ,eo}}-f7zt|}>p/89tJ6 J53!iA?lk[Ph#'%3$2]A,ԟsi6y]$0װ`oӍ8U֐dW3$C7xN].w['RlFmI'>Ef@,Șn+U%c!WެlG) ,qo)'Ε$ҤFFF]HmiO&9۔We\Z_e1m(g_1mIcHp}xeKJ3='4cr@n>lyťm*[qjПQB""f)6踶lZMk2JRF)FDF~/Ys'L.n7QZ9a*+2*+]}n5tġ-*SO!+O^Iث_cN~kD'Q)OU&OS(94YX~"6J$f^#JG0B/O q?90*(k_;,.<׫ qTM>cLoT,ƺuCnGLVN_k˚ڎniG˕o${enIQrIL{]{MzgV60RkE)٬%MDyLx#IS2/ȿt>#dtݦ`xn[TDKsw2zJa*OF{FNьlk3G\+st&=O_oW4 woގRǚ3]#V\\6RrppC>P2vkhݛb[rFy(uhq [&IAx̌Kq~2W<ĸE?46~K]N2YTD&֗%} ]} TtߛB~"'&^􍷮k4iMNX&H}wFܘSo^)i3e{)Գ/*J$' dFeԄ!2qo46fLOh%5)4*C: IUVC1]\h8x/z d:)vj9+G;%^}""~][ri>{Fޤ䕌fhȒjdf'2p6bZ#2ۈYJ6UG&ҤSmu3Vz޹*yF^#E$ˣm=AɦTnm4RnKg*U"~s,9Chջ-pӌjU>EbW%D蹌HxtE(fQJQ3QE2?Ij(J[J[BR!$! $ O%$^_!?)2 ]z(K9^__XpHeDeDF)EMDddd##%)&]FG2}uuUsPU[Meg[R,XqP$8ّH]jj2cRiqׁNYfT5FWg_S͉gKevCYnKIo\6[~֦S2#2TI ,[2_7zZ,e9 RZ3 iҚ^Z沠6~ga2F^8쬟cMe藸"]XRi)rKQ9pF|E|Dʜ'9qE̮#\)2q8,D*܌%&D!>ռnw󈍸0s:,De'L& _mو_KD'-uh:}n^_m;ywfn-)=C^\ qmqhΣZp&N(mh-㏿=4r[yX-~Wj9KԆ:Ō;ͱ}q[=.a%WH粍 RRֵ)%-fFT/ų,([nRn%;r!rHqmWkKu,;5~MPK?#r%6?Qհr-m 2HIKZ.dB@[OXzf;l~)Dgxy{%܄egHX.KÛ&qJJUښk/e8GO}7e* eWF9 6grlGK5ؗW>UW}Р2r؇KK++Z[[ZLagmga!Rϖﺵ:ΩKZjQ#*I$].ݜݓm|[oommu5t zjŭL,8!EJe[J[iIBH""!Ł~f7ݾԽx<3Ute to( ]HC;jeFKַr/Pi׏lzs\n5qhIV'N8:Qion_BD-U&Q^cocA˫2$^ItCͬkuuRݜn>̂;Jc-Ա3ٌI[Q*#L E,/M櫮CQav")χbmU7E'AڟRvO&ڧg#}JۣMw8;r~첧rZ[u-z^}mƐd b$_9SyǍ54_<rOɲ~l>dՃ'y;EY#sؓYB W7b^Q=w!Z C64$=wUF͌I90Du2g~<i&E}/vu8bVmK[qiչZtd%_T 3whT4Pgo-.ͰEKnyd6e2c}.[Dr' 1:Ò~[:oB_h8|zn=eJH'*^B]tɸlJ?i;gƥn[m%(f۸znm̕qbP3\Tk+`9gr ˈ9rEqs D̟۫G7r;vt#d@owrPpct}%o7uIKUYpao<ٝ{̤֬|JE ?PޅJTh?C13PӤfvӔZROqŒkqm5̀inCh~G3Ħb[73࡙=I#*:ҤO J$VPٍ:m̎.q:vHi3CLR2ėRCZҴj96ӺR\~3zvv-˱CH*kq#+Q":PsjX CO⭺9>J"̓g g+3y15)^$׷v/WC~3融IOUܺD~>S!jY 2'U IGEܦ]4jӌ}y*\נG%~*ki˩v$Dhdf>+\%GOݨ|RKQ$!>2 ϣmlu="sh>޾@٧%9M8OD˪ \if^unnmQ;vn,X>J4_EVynݵMzW+\W\8)aUEixÃM_P\ F33k䪝vZMJqU^c/*zfFږ QPհRu%Kla$EВI!]rz.-mY!c[NJbT]˱WFGmq6VQoed֮f<$S3/ju?oRW_c |>ǯC=eԽD^~oBWO} HxT8TOAxt/X5zxO/Iu6c)Bjvیӣ^]۽$qx:7F3D{F%Y~TjyX\V˗YsKein+ܘr[WnDgP*! j1Z|ʻ3"|tHZEZ:ʩo &{\fgg5WwEͯr)+:M; /c&m)L iwMc%:?ڮbOm=|Zc)O.߹^sv7XhP|yTYH211(8In)'Y>LS'nf뗔+uXj67IH$ŧ[zfjVvՉ+y]5 JJTUqqSakvrg[ZO[H}5(ϩm݋J͈)$I$KK}oK#"nw&۔m٘Ĩi|RqT;A[:bWTUW#Fa%Xe"JRDDCJG6 oZ*g㞠rbʱc4 3RDSQCIYL8-tz6^´h4=+ޗbShP\.dY0;Xs&761wǰdˏ5 t{fudoZPdDN|4BZݽB0^>#_\\r.쮘irqUU=UN|TwpGVO\H{a:oj]AS:'Zҵ~6A#ؖ'>fuy9d[ {},5$wԴ#Mv jOA ߥ['o(ii%Aʿu8i>&ɳgv uPkZ_k*Ɩf.8fA2yҸz3`"4sZֺ{հeq]"t%> ~&-7U+9FoCM$7( G!iJJe␷E N䔾5Ek&7BH\uWO%u?*8D}HP{pi\7r1],>x~I[ mnjДsR9.%Wk}+p-ȝ;rqn?'"[QQZ$uwM7kufZ~=Ζ1̬(䨬KDF~^H]pz\&OnQ ~eŒ[\p~}Ȳ4ggrKT3r̴@Ap_ˋ5myU^tea6NI%7s^s\z9!iӹV̌%lTiğC 22#2%kGȏ=3^*F1$rpož6S塓l?|D5\`YVԃ ǯl$1r%U] vހٵu/"aKW\}U>kc=~ݨYk+ m}EqbGsaqKI=NlGĽo^z2P_\W|+z|\(g |)H~_OY# }o/z^1Y!}B>2o#)Iɔ+5;GayW8ynmq6~hՠ(vTO+\!{Y5^\xձԳ'lT#Jk ?H,]\,޺ޣ_ ߿̋ ۂ̼V+k\ۓn'U0y&^Udy[ОEkQ? iυLvmɭg.V5!f7[)O&G*K' Rc۴c;9c&kˮ~M߽#_LhM_-rAIjJW_l[mL Ǫj?#bC^n6B$=8zˈڥ'!"V{S}6[Y_"f"Ia:VNdmSҾ33`m=/>$Js?)N/ҥp0羻1llbZ~:N5$+H[&k`pW\iK B"=dFڇW n-lZY I!-D2R6.E!ơr~-,jݏ. pT]{唛?ey9FdZ^X-N).}͂kZN5)J33ק]>>OOz:OAO9_OR?HT8iuzolx^P@ m]<|:6}Bn/OO_Hp7ç}_^`}X& |LC58i2#}:UˋQfJ!r'E4fǝ25T.a]ݵ%Mk-Üm{~ʯ֛ꮗ"j7<\UH}V(Q!k{>gqhױ[v|xZF'Q1(ڿnnk]IV)CZז/g[;Lw \]ؘo#{ƴe̱id)%cjeq%G)!Rkv3R|1>ϕrG}m gwIqPAz[I~No2od s3Ȭ9Kqe[==\\TՓQl>Kjg3+ƐIdFIu?/P/)y3Np?},8㫷qy _`Xd"d;vDkYvv,%zb!Γjێy.n~s8WV`uWNRUL&֖,2y*MRj梒rJFx ݗ7*EpkhKl?Hŗlwrw3:z~+܁VvzeΪԛz$Q@CC%L zZiq)([:.2Əqm"_vjIԮX9ڄU.όU)2Wk(|yWǽ}X\WeGQ1ti'9~5SD+S7%g>RT$>6>e(WSO{ !!$!#o|ESx%O)q>5oW_GU82>G_Խ]D^T5zz>I^._u}_""} B/쿠 tx޿0<׻0^ܣ]"D7nƒ6+%.+-"oR\JĢl6dg5Q=Mˍʿ(ŸNƚ~YgE ^snDiTvϽīښУvf䨌1*ŝN-KR#fXVW֡l(YȻI%mu>˧I[5yYijo>K>cܫ5}-{ i:*&IwK#ݤv>Bh\NK:׊tv[fr^ )H5\v*V2#?GM7έ۠c*{KJ'I)q4}k|h2[iԙFgiy 9rݵ%(O5ƟKմ}_OeJ"Oҩv+-I&owLb[ReuvYMzk2XH96~*#/,xp<(<eEqgIDIN{h5"1ʆh:61./Z=(qx>i6вvwKOut+U^$SR]W]ӋwL2U,ɴӪ`ŷC$v='پ;<b^a^{O,HgfrPa9uyސ׉L8E^%c)i99j;k6.5oJmIuߡF̍qXGŲ~]a/_Xd =\܂6W*hF1R2;߿nΣē1>lc!LŒC-YQ2>؜-ޜa+ óc +&.c۔isM)&w߸Ly~8 f) qG{[Wqiz{^8qZkqdHI";ۅپ`b3jè-r\Q :}TD~FC"knDn픚^tHyc[ے"'$:aasܳ1ZNEM^Uxc]M Y|8rY5SOIVvm{Vt5y/5vfJgAT(GzSo ˫!_M*DKyFu1,5%:V"co+#5{GW8ͻzCq 8EIfDI /pk1 R~j5b2#W*:UuR .*?qk|֝"KUWU{otmh<|>si|^ FpPttHOpo3o[[6+}r Z%']t+ h9b]ax <'uVHJ:, /QR^".] ^G %;x/IcDB1S}Ha2ǞY ̵KQ:1Tqg|x]M]O ٘CY΍Im8>L)JJUe`ЛR=G|vƳori+n>cW1}ŻMgԮzϲ)qiv4DKwo[) X]mDZ-ԢɞiƟP⊦i#"|AWFbOIܺ* џXDˍG}Cv1CKIΏr/d<^_!U}Ԫ5uuC[Xm^Ju6yq<{VkE:]E+XkI!>3wl3lC/!GHbH4_xs$Ξ).Z7+0_HЃ'y;EY#sؓYB ̌xz ݅;Gvmݒ6T m*--e]ME1ad r R[1_=t>z>c4z~KПjN]vZ"KVQo{.WN< ӏpqM喌 'orZf@cRFL_&}JNoWtmr./BHI`__\ ~Fg^R;:_5y^gPiuT`:4piH_IS}Ѐ<}? _8SgP~OQ yGqOQ@m+?GkCx<#Euoz}Pi4 ] _Ժ|_u?:Otm4W_jI!]6c.StO=-:]2LlxG]za'iY- "}>z}ؼwzwjLf+M]b}{\-}ILȓͷ.qDyn>s .\Q:^mC\-II?O2UR]6f_um}O4~Mi,K1C*l)m)DfԖ$I%0mҒiQzi+w(7¶U\fF- JԎč%t>4TjW˜]|h蟾{Mj]FeFkxI&ziN y7q{>e'";W9^3S֬bqFyƼO$ĤuA'7 KcI9A^NI$M>`WL)fe/)|#tp< U')E_+QVūnx}\m(ʊf>wǞ\8[nHQ@yU)t.EJe5ݩ|I'&D#3Rϯ؃WB`BVeZ*&Y-SȈܝy/*[=()pX3RzzzX7M$=܄_F2<{;#)'nߙ9'-\nfW+5sJfW`)zݧ:؄땓f6߶Q(%fv]3}FLJZ֥)G3/*+9\7W&~-eŋ hТhf,X6YaLM%)JHAǁ~N;\F{Ls;߻1u M%ZumQVVCc唟wq3AɝcܿzϚ,zNM*R| VZz>V}uԊv&)Q*ۤyiās8·v-kPyrI>}h)m6mǻrN"Rz_.c ƵpLQF˞՗i|Ҫ|)tIZÆQGiHBlʻcϹbv~nr._qqG +j\ײ2:T&U0}#4+SN?mbs)i {{bvԭU%d6٨TviZTVvٝ;PX^]a!&BheKb J/c3$Kn" urd6Y&7^}^[?f7gEcN ?1gEqi]{jغA5~} Vz'JKnb!)e%k<-Jjo4 z.l65uRc3DO9{2e UuZVcZa X}zޕB+0\Wm]1*qTuum5Tr]#ͻ<7syY)O\ʌRTnӏ5x&1%\5(7ϯzס7dm]xx Qx}oU8=t~ s76ufBm1h#(HnZ d8fDf;XDq0-JvF*}.iԵL 'YzۄU[m.k]iV|P.aTjms=o~}n=wrqwi4F%F퍔[$"%'p1~;"2E|LZV>6h9z[إ+K<:etPJ,r%ڬ\eFL+ X[n<./"׻i&&۷rrh"`sk\]7rPJ퍕wм~a^5M>3<`g9,gy}Y̧fYY8" yP$")=[1Ƅm*1I$ p ̹+'Mɿ}ػz:x֘v5`1GDZH ͋[QTL4T~DFjWUaP}\:xslhߤm#~Y#у'y;EY#sؓYB B??һ+& Iŵt&:˪VmJy-P,\|yA\q8/iWڸ<̌ fbMXw?i4m4h3Y_f:jbT8+4O(mY/ԤT8JY%ԇk.Wr.5ّw>v%u~Fr.Ǣf m=*0T1-zv;*ǻYZ]};Uhn67fW"#r=t]}n\9(ͯ/.5N)ҽ3H7V=dir^%Xqa.17ʟm.Ko/ymzs:c8KuXi/ٔ[xҊ:V~eGS.t3y1@/<n܊ґ㊳? OÁ{/_r3e䗕~C4C4g V|~ǰ{Gz>dTUJ)/C8J|!v+ˇ1˩k&ǚt"6]-^SMHanA->b#>D|f:)v[5!͇b1=XRTIuJ̺vnqI:bds;e 狋  j6cʂͭE%f\iRطm^N2VTHtP9:)r\:·v "T^-$i6Op.FTyU|~~9 \;5dHjR~[n77"Bzu1]K-+U G0 *uȐ5ak$",WİPkQtϩc}6~ڲ'97]5j2!5n߂j*)b=%㾱sQj\{hw!af#O#,3kge(x^n: vWsAB4[:vr(&[JRnumAiWGg iӹ?Or1MsFeW}ϱe}M ξUVOZ|*J2K\贒fEԇ>G& v6 qM6geu-בI3SEu\_3(̔vokkԳ]!mvwF>.O_xд\0qtj'UI.IZIn[jqbKv\&ȕqh|؄'LM5%Rj7RiĞ*.zR1*i.3,{4?.uO M6K1$j^e F槚ikXGл][u7Gm{oJb*(Y][Q,c>\Ns<7Ih'պSbz%H6A9:cg?& ?}E?"Meqyw5: :Wo3YGITI_#en&#}\wM,*QnoM>I) 6fNfFMU<+mΖj99Zx-S͒}$3xzVMÞOp6-Pozbs>׊Zy18471n9PJJ8X.9Y͎Ng9s>ȶ+|h_y5N a]a5]\o %)7ue9Jteڏ}>4uZο'T+J{ɳ;`g[Qc:֕2h1?1̬l47le85RPj2i JEȳV+x?䟹;eF#o|} ҃'y;EY#sؓYB vwvc;icݎBT::7(36OIudI1Qy^$dG#fӿv8܃|/jM?{z[]mžKq]µ+)%|GzW }oGѮZ+rܢ.-i\̧ kJI ,ҥ6cQk'dP_(4j4x&`C$F ~j tx@iI}O_Ns#?zx?) S5~:?_o_.==W/:S0h~']:C?ӯP<=?7~˧^OW}>@::O_ 4^r BZOִ'G$2N.Yiח[2.m&/Cϼa:n{X\k £GMQxulf^.o6ucj[n^e$7vJF#ap[Mq˂qcX ԏs28[%U/޷by!n.R~ *#<̫x~=dWgTγ=u;(P1s,r1Rݼ%fdvY_|3,C%>5![׉qYe)DX؇0:b%h6e> \,]Nŵ]ٻk~2's)%ȵ{p߱bnUU))SBȻZbY?)W#j8_&d]{'ORk^xiFUԲm`122j .IqOl{KVěKFTsRV}h`KCC0n}ZZv76^]}ۏv2ͻwR8bayUIj|kZR퓢mQƾ.H8ÞGEl޷)CS)eB %N%m)ԋFy)ӜY4ۅatOjJOEZZ!(f+ z~?8.')KRu{lzS:mپ *B 4R.K*GGٯ$&M+iut,e[X(w.F4P^LDZKԜ!nI̻]y}ǾZ

1DیAnBW12£ֵIm{ \'QԘ?)twc_Lh@x/g-QZfQq_xwWv"TyhmIJ2"!˖lڕQSmDoIvoG.sQRmI.#(0z-_2,tzj::xk4h6yPdDckk~<y5m)w:mّEyͣݛ^b\J}&Xb幵kaƽ?jbMnzsa?)'~>UNUkmʭ8>g{w-hz}C%ul ~AU`ߚ.9:SCr'B3n2jq5y[m*Z̉>wDgЈE0?2GM.{#ҟL2I-CMQ6Mk2.QR^3".c \5uYV5Ei;+e4R+ 2'LGhqgs޺~~z_ zHsCA9rH> )vG_Y4I&fbn,><ت46ڣ*ɩ4)ojQ$X7R eAOT*JOpwetʝ rSj渄N)Pݿ`\وG.C=>v[`Sց4=ms]hz"ښ7ƿw ӻ^<_*|c7hvce;uCwLj\̏UfQSX20JaO@W1?sw?&˖F8_?Ӄ'y;EY#sؓYB K¾IXpOOlJ\}:P%j_iU%0ê8Ȍۭi4d/hbI$/]cSVgY%4i72׹zNdq?~~TwN#_(,c r"M& Y3ZKf=KȽ'UCT=uFa™_%_h{IG")"'qJQm#P%[p|}_cOkn†nqMIqIOSªn#ٽx.O$tOH&MeyTw[fwIɊ-Q7)%6U?[G@DiOt#?cO6|/)]C4< OO|z}NOj6^R}.н&~|ïP= "?Ym0io]}=}]: ~_kwꊇ>w_\}x6OGO'w5&g>z]ϺGк=N]}_'ïؐ?Li1་fE g4ĶZϘ~_5=m^*/ImǚJ _ K!cϕ7؟u}ρ.+\jjBK6OLTҗB]L^K{g7~ٞrM|̶eRA8$C#B˹Ⱦ=hSTk>LVZCkG-U)VWlb|K%)^ȅHu_#$.ٺS廁o p#׍)bVt[z~x\X5deNgUH6$'Z&_7mݥ[viv*L]Ak oXZJ]Qci?zI?9p$7Y`HdNUm|9&­&ۦ=|ͨiMVƷXv]m}̻%VI=ӽIj״hK%Å\ZIYV=| ή&hTkŴ]W]Y!qS0J05U isi3qs,ڀ+:uk=bk^eVvwDzTGRKePͰqncO2..x>TPf%5֏$SMŃLڳ=Pl٧^sg4]]tʛl_CqII24EBOki-vseXΒ➗2t&\O/N8┵Lh0TK#;7rnm߫B $x5ձc@#Hb,(0Lx#0Pm(B]9>O5"5x?; T\A6^.U)~28~Ag&q"C&9>V۩Iv2,dǚSjuU\~k++ je[,ONNl,eIu]f.ׯq[XwyMUmcq])EWy_GZSCw07)s=qAn䬣[z>m ǫBM5)U"5[DҊKVla锫)IuTm'Y-hvqfzur}1TQKnRyl 9퉹0;r5M69%޵]_,8T.0PunwN.'cd~!2ZMD%/2CMqIBcyy2Pm9Iė]/":|JRiZX~_N{ԛK)͚Ikeq!-9&sFwQxdQ9?E/qx_Xrqi:.4D6]ڇWeu ^~%A4 W"u,`)ufFħ\gҙo\Iҗnsrfoȟ{:m^+-h^Խtcܫ$+ GTNٝ{VѵI\Ij2 b"I-JE',ȲbΉ}|vuXVJfu}t.lSOǐBФ&ddb q8-Mv'WmݶZe5q'͟Wi_aQmUa>kk=\I-;LwRKm) "RL~|4EO7z_/S 'DE}z[ _)5}oEЀ?G@]>O:u? }̾CD O-?HOx^z}~zzzKǡN>vX_/ 5 6mZդ>'++2EBmkMvANOCm_Z˨ϼ"EպSВVv "Х,Lqfb6m7G'3lCȭ#pkٿdwzLW>ut􉿣b_}z)6@t8M*~Udn \Ť JYo BRSVڽG"?A ZjYb7ot<~CrXT%nU9}jYKqFm Wwnvѻٽ'{s.g‹L{w; xYڏ%5mUuNQ_W&+k-n|%KMno> ƛ85,qfeMَ~o~JR^$r%b%msl[[^53K'.(G#RֵRF%&eK#"5ddIBrtI._#3"s7Hv]./3 fQ6SE`xUMe5Z svVֶseҥkW.dBpjJi}8pM:Tn#9,J[.^5DdOnCwn>&3lꩨ9|3* ۚ{iIR}g!Uݼa]O2YuN I͠h4_RۈI+?dRL}كCvSE%jTHvԩl8y݆r53.[ʘJ[-+.:ۑnߙ?C^JSkTWZ1쮜iR_M/eI%9j1Kۧƣq#7K`:9n-zrmmX%S\ 3lG'R!QAoxuTeFII.T~_`+$ Q$#ZfDT(^33̮|:e;y +afRj42z~S6J*\2.IKIm-sqVնS){@V'6nj+sNM9&_ dsS$Pع`{i/Eʥmy&?bϡjggV5{rz%׽#9)} LUԓ\\}/*>LM#'=}.Y²|5s[]돧Xrw/⪹}eV&_ۇ^r`9Mrv֮*ہ1Tܔ9jg}0\KS7-I2RQޛ6]vΰ%L}S&̔*\O-JZֵ3331#I$B/99Ͷ۫omIÇ$X"ƃ f!… D3DxcICmBIJH` /'tNrѿH_6GkGՃ'y;EY#sؓYB a}uTqvC18#Q)>Lz&%Tq[IIDjR1!sߔW3$~pW,ڔFr(F*½uWvJǫUl=O\ *Cn]b*r7fdOM-)5y_^z~tFHj:~'P5?1N1/7gx2[ԋ [ǧHx|zi>>Wj <>_z>w__?<ǡ_ l.yz \~9Ϡ !T|J۶Ĭ*bna-(zdlL~bl܁\ӝKʢs~#zUw#˒jRt_o7X^%Grk͵I0m{'Mھ=L-t/Ql)59.6-IZB$>rxCd R=@㋒ɮ:xLEڎK 6{]=/%Gv|]4IrXr}?J&]JyVaPRy Ȉz]UunhW*Dsd!NL$-7ŐqҶq'iZ+JҢHˠ_;;EpdxX, .buy{K?Q4f&nįƅQo!ٔr))0O8wscZ:|k=)`KSy[Hu~RJUl?rۚ|pɥ9^/dyMw(vT&fIy..Uqi| *{-ȳik.e4nGIǑr$|Nw_ZO +qӵ9DWl]ar[PϷǔiO"S|왥\Z9Ŝ\ܜj̉[. ۍmex=qeIJ*JW#JRmDR΋4v)2~L^Z-Y][p|`8UŮd,WpxW6y=y#UmL2 ''$9:lR*.#ͯsdK/ڈR3]\bיwBqLOky}ud1bRֵ(蔑FII|_o̲2$&&]66FfD1q`\-}q|gxfr}r,'¨r\. LeK4,Rֵ]LȇggNxwncfN'-ʉ1L l)M$PKƎێInL]%% jڸZj\[VǽswKyϹld p܂/On\y\9j?ΨYO. #1Unjdƕ=qŒ7~Q9!)+h+YqiA-!*"2'knV}K_m,%O}$vߍ{/zԾ'LwÏ Uspj_RMQJS{TJfwv<.["V__1 ;Nk6iOe 4a|YH$`H8uGg#ó9#/ Jp|ɧr<.}'EYMyKjjޛaNZ/ǶO;[Ky4 [pe,M.ӸG)QЕd"Z/9 j{==UQA,?1kB!k9m#ʃZVJu>[>ںڼYQ3co)}L0,3xwJKI!2&T:˻vʣ[ovw#c,>4q/2\zixLzgw9ڈȓa?'LhF,MqDJDI-ckTh^ud|_Hbfrbh%(dHJJW^JHLDBs6)IB)(Bn-k2JU)jWzLX0ۂ5r^>⧫QO;f{~}<̴6:֯W/d+y65*iZru2Sf'7v ͪq9/UKTiٜݜ2㖖%,Xo `V2=e,-˗BĚt4?PGğ} JqCVK)0ՑVf{d0]#iNOν'PfJBns]oFoߗIR_mY?D:jR%ˍCe'Be gCϹW`/ŰE6AP]Z0'mf^Uʙum$JI&#Qƺ-o+KiNζkki9yLy՟qjQۊ$Hݻ~zNsmI5U5T5)h SSCbeML(Օc6MFDZmICm"""!ÎO}\:xslhߤm#~Y#փ'y;EY#sؓYB =am&Li˝/!gUPKasDg4-_~BL:1uV:%p6_Zn9:ts5XWT^ˎ9.,Tn5sr 4fw!;z5-FF{&țJH,J?,}|f}"&&,#^Ht_8"/`~OGO6ïzusp}.| ErAT |Ku O}_)E@NzPpR/WB~ENez:}p:=~'OO~_/>zzH7b.xj>ՙ` MJ T6KǢ#/1=9.7('趻jvjx\d \tQJ^R';i%㔜{kn:me^5kbK4)ol3iY8ң4&B^ [`Nu%eceOaҾR>4.,T882|n\nM?JuG 5)[K'őK+$ƒѰjJIQ9OM'Ȝ*s6޻rg=m/謘&7%2nMe3`dϪT鮵OF4ɧjm*ź^FmZιX5KN_ceN JQO'=MfmD;A\~"4EsΜqDTݏkE&JI*RI.mnۖ"q gaqjò#2$qőz}"YoLs&i+tc0`ݡzi(KMsufS>ƍMgPNp鷞rJ=n]-VdOvܦiZE}sK*wv^Q7+=GLɞ{XBY*R_DW)Br{îpc3'Dk[saŌJ6-4>m F#o,Tڔ^3l~O/qk5r]d~>ύ,'uۚ4\$V/r=]l ]K+OPމ`î#ky PKJVBxuly>0@Dx6$9j;)͓r̺ޫ} +[kb rDK!Dma~`k: h6?TʳO6dB.28,:9Pno> Cy<m뮱]Pnb۷Unh}&ߥQw?a!vvI*q__U&ғm^}ܭ<Uo]wDǦKjT;%wr{Ǿ)LWgeHꔟjJl˼̔ʏnV.6:Ny2趟Q-=RQ:.Yq}5;}"+)$r> Wgn{\mc ]1ĬSPmO<6TG'#T7QӠ˶:D0ָN+Np ~;N?b"}*R}\>ԳL]ۧw%TDiZ~acij vE%ܓ\hU|_ s.BgRnڹزE;"Zń}iw'D4v< /%y6kuDBqjPDB\`%r)ɒ[q u$3wu V<÷d6#.)# ;ٮ&Ty5Iph3cf::W1yv_+S*sKa;sn9Zʼ^_֝kF}/FLxQ#[at+Uy7KV8j쟗3.: S@qYMnH|-םZԷYđPRKKIw$E.\7v윥'Vm"Z5jk"#+l 8CM4m""""H9}\:xslhߤm#~Y#׃'y;EY#sؓYB y>nPEqlC ȭ 3iT5fXN ӐW}|=_(:RgiV3WW#U5rI'[ݛ^_ .:;qoy|CrDcÆXwt?e-DEq^dDg&)&22>G]qz6ԩ+JT%iZR- %,IQxxGU3=p?Rzp/@éF7zKQzu0tQ=~>S0 ^/ɀm˧.kB>@}ratst?=]z hk0˒f;(tTMiB!C(WUG)1%Nn4(ʐ⌒،Ѽԣ%&fg<9#ܧ9ej Xmk談ِ W5mVpd'9xU4jOUݙ)k-rI)J٣x7޺5v[c+nt n/2r]IJVo;$CQ/L2Ɍ<JZ6퉢*u۽C*t˧&/[O_-ŵ zBc%)y\ydjQtSWDipVU}tTFLZvҳ:{=z5ǂM}ғ_̻$7y*>=cº55H2k(dnM5]HgI)VKo^=)`o:ge`>"Aqqjؚ&#ILWFzn_}sG۔8%$ߢ>ǸɎ9o:ԝENv≥_ETf #ABz& SJȖ~CP/ ]lut 2aM!Epؓ- J?Aܤꪻ' 4׃]3%eEy10_aI8̺ٚT$IRLϗkYNb7 yj&驟38sZ;bwrn,x)S)_Ri CDMѳO>Naqa-p̺"O`W/:kK"4~: \"\ vȾ[@AN< {Gte_j #RdSlu$5+ذNk[LIϕe*[_oлtO'OU9G-Ů{zwVO5^2qd?gmjW6r4jTmWi0_;R"-l1+XWEZ^LĄ6cqt0jͺF7ђD 2zJe)+ǍoXw.gҳHFĂ.x~Hm4N}48.v$E&/=;r3{nr')iLzERz>.='Y.:Lr}W>,&pLJkRuy8=P@ڢ[*:)[6ҭ&$N8k)kZiZ)FKBSt);_7O/?;?<5 2<mGq6դ2ǙY"V;C%n|{cǓ5n-N8)(ֵKZ}T(LMnnY:*,SWN$63LD TמujJm""30rb7D]fڋUm>|3m-&ĭ&},Å6U"\ٲ)-MN8$$jQnφvg67\qS;v5<{7ۍi JW=<Х +nnr&LEߢ<;3& =SUrX2\h2q"܇a:!&J.KnhQ;hI pUCtKtη ΔIh9ɭ)ΪEDZCV6Os%NMx_}UDJmCXyv}xEvEzFb=2mWVV蜛|H>BnS+ȽmuVAHADylo bp(Z2I5]ZMԭjU_:У{LPTH[JyPuukJHGE}R*Q擢c!+}K=k!l0ON-FIBfDDfc\q+ldm\O0zFJW6P&Q'HegZOwKk/_u]zHq7ohNVcsC֣gTGJN2KR39>:'_նuDV%-_[{B#KoIn!C/LBs0\.i$xN ,}>SmG}1uP(Ҩ.jкwZ]^_ou&>*d z+v.}썷S> :6"W TM6i2K*̦6.YiAGdם%7L%Tu"R|ndĚIE/O}RvL."L-d>qy5)jQ6ܤٝ6mee[CLi 6m%)""""EC}\:xslhߤm#~Y#Ѓ'y;EY#sؓYB /MqiU_X˩sMkƝYkY)!HlMC'*"2 c8sI*4j~ۖn85(ښuMzSqֵu׵Tw0"ZS@Wk[=Ic[aP@48-mfF] z`vǞr3-"XTۿ\9;Ls,'ؒriKtiRХZMbYY)ʉ*V]~2⍼Bu*2md[J3qqUDҋrsK?hnEp7ٽE"Dl[ n)})rk~fF,.(TkAʎDj&ҷJ!Dkyzydlȍ G: 3:;3q~> zc%=/Qհ-j8IqNIӱѦjQf}sCl[魋k1Oǧ} ŴJQ*'ӧ#^tFGbIx|`kEPiU|_PT|/O ás^>0r+~>ҽGkZ_3C z&*dqG)3.d]KQsа>qtv"d,ۓQZNNչIUU7OSwU.#6G&ykN=ooMu\Zq䷉ï!&K N-=|J&G:t9,%=6}3'K❑*d2_q}MKqjR331$rNSumտY,x1Ç0X"aih(BD!$DDDDDD??HY Ж+.Ikŝ^~_)k5|)F|}FYsZ]9>[b, Q\{+VLA j?uaDaNh$$%|| $^uqN-ؒD3 'Գ%U$RnJxFI^ ax)"_dQ6iEZ҆ҟ%$j2!lO<[y ZP-ͦΫ(VUr;mPҔ>dw.]ѱ._ݛ|5.E^=kv-nc>k~uI/CIѮׇVA𳉹^YQiA^qMMɩnJ܅ZwQe(nTE&J]J=: EB]`_p#+]i͉5W5d5rY:^F+ejK.j"&5ڇ[PBc³<⻗$+-.Zvsj/o*#/[RunndHvq/k̲LzxlilV{u*m T쫸1h%PIDPIݐO>linLq,ܙ$D|jgcr Le*CG)}9`}mrűKp^w]~$ӽGt_NZ5Δׄ+؛TiU.YS=;5[&W±S9 u9NW 5%qV3]PiZ#SqWb:;Akyq}ڃeǟ:OBw}dUi6b?JPIBuSj7˓}wF+%ܑ:>۷V&ܛ v&6g.E[ 2/S0 sd-z:d2K-Wn>^r7ܻ|/bo)M*NFt ח1 M[c۫#S1֩w"J ɔ5v+VsO;_E(K$ghUr-x/O;8G3yDž?M9_<կFOv?6 q1ğOC)vɹ3D?fĘ1Ȑ%dHHu:qמu5)JQ1/+.?%棰|μi8DELf=Γ_-,ܛJ!_W+mY#x=SSӡᛋ}[v29 նOr쇿W?9$uA7rjrto.o8Y5]doD6mD*4s-#f+_5~fOѸNu!7~ voVzGDBIiFj/4sϚcy&^ԶE±PMjQf]ڽJsTálRx|˫˔G,u}nfԪuiҩ4ʉrpWx0fOjm v.}FmRbJa)M5|uSuip_xs$Ξ).Z7+0_Hу'y;EY#sؓYB ]89.o`ntRo N9T*+Bs/g]^hpnI0˫蓵Fz6r|e/Db m[_X]\u)eiƊ}ɖˎs_X{U2umfZiknIKI}2BGU?k.\W*qY  NCk 1桔IKx M˫}acJ<\dKn}󶶐܏=մaWWӛf]ͻ/;qY>iq(X$;l3͹bَŪ5VN$xopeIp0A_XLg _1R>/^|?3x~ _GS'5q _>O>P?.L?\>C^seONL(}? ^zz@"ƻLUꥺӷcq Q鮶s =ˢ\t ^cH:in773XkO}UɄWUmk3KQ{C0OjM[rIFڶk5qÒ7uG抸`m ^s#`l[ i+{Sli8~Q"*54|Zu#$QkxUv̫Qi?I#9k-)qnѸ܋\sIU)Ar'yzq ʙAș' 't>J]-^tKz[ yR"5)U4ćnx- ҿZ5 6hE; #[V=?mJίz*KU4 Vdך̨T Q\jT|Uhw$0>_qM[[?1Âe!<+),EٙS*lZY1& .: p\@^p-uO Klu|"#pJD#7L̛NѣbcjRtds̒}_tM륓fԩzկ29%8G\ԂU#Y+9/FY~Ǭ骶!pn?fϽv5}ԃ:^eM8^Cw"fS%FhidvT.ň`5ݬ~;`x >c1]`  ũ Gp&،V򩢝, G= q֢([z~kE&`g:NT\Ϗ-}TtN2*p7fԖAC?:KrI܃$/㵗v$?;2k7bY^[7%J4A+!4\H*p,ePLe'% (:*ggtJ뼻hl ةpI<%HyiQ1RMO В32plK32m[lK}v㷃Y Ԯ}UrK%iИ ;՚;+ejfi[Kju-fI9vm0c"rUc{*>4NUe%Dm rEKD3fBSTN/E`vwG(NJ>'>rp&Bǹϗl2)ۑZ}RyUV*>"XmS06 YҸc$IKxo ^ޛ U\CYcy zo'Mū!t/+h^}ܯݛm+)KŶL:3:,[TU[N< e:7;k&s~E]^Mqq{I6sInWp ~< IA32-`q7~ɩx`JqMrƂmD6\sM0tG;Xk'"4q??s|rf>jX*x^p8n\q'\j.kƹjuxQ_5U_ KMuhw+)7cklr-z>Q]*yzvuҎƨzTơljHYB֐n &i+5A(Ż[nΏ;劳wt${zK؅Ln.O]r-I6Z-68eLn'J^ͳj=R\V,/g{'Ȫ H\䶎Vg!v6;u0YϞjr ;T.]B.yDdj}'o{_/PL:*aZ{;x)1 JɴȎH.6Mh'#AkԭKU4veץk<{Slmҍ7I3u2{h${)ʼW/ki}˾"^Lr~K;(d9aRvrU=JdMs-c?8))C6o3 Q&bhzKi)^;M2tCm% "JR]E͹:%؇tbĸolcBeןy;%o?&Kă:kg_*BξRqjR\7avVg7YofWTF;-kԥ$j)2>}2fn-oXxeRMG]ߛo@RfD]_NҎ*{Ski]t) 9~gn6iN%ʁm"WCVK%ĔDdb36nDo:2W8gnwbgQj~ 4Ppj9K~GSnw{_K$7PnօaY.ڦ"ÌOIQ*nK}n[v2c=Ob-2[=[sެ%u/Ll ˞Mr!VMv:Ng,ȥɣtmhezHI?'N[&jz毬5LIU~ kKN&c lњM%bCxV3_!ZWc`FnNȺ[x}\:xslhߤm#~Y#҃'y;EY#sؓYB T4\85YuX#+K/3,ijȯ|]\[H;rj?kB>^dx}|>Cj6xtS#^)q>>_AT >z3 hExt3[zAK9#/*]| =EN Kc+[v 4h=ն%@p?"oRe)C(rPfԋJ͋9+]/(ʯcIT^E3&QBܕ䚚K6/Kfd<֚bz;)dOX}%KוX1FreAy9#[ɐlK"]oԯ^ UmV.1rcRtI/M^;eU-Y&Aq-4Tcmmg6AydIJLwZzq/NIVmdˑd127(ߏUM$8b(JQ]3j`­y+kIƵr^5DzY,jxlȹ %*~NiEok}ã76oKK_g̤iiQܭ(e´l+8-5ՠT)٭1(X䶮Hq D:j(]Z-FDMeRt".ڵ+i&{l٬4Nj-G>Ro+@rn Z<<Mk)U(Jv\|G" ndM[G=/1jTQ*-3K DI.DCt01cg=*xF*?h-KT&ݝ?Ś?Z@_QiEnX&Pu8V/eQA&1(5^3WQGhPon{nM!WIk2jӨ3gK-j3IuPƷ{*R8ccnmg6R.$Ƒ8b~#vҴڔm-;k_l#Cw $՚HrYs_a7E6ݶ$ Z׏V؋\a/=JJ5*B3>]II~RKT+uo&ŝхn}IU9\d|*so-2U[CDݤϦ̪M0Ʈ\U$m|Qjy&k7qN"uG%ug:*A$uyiP V@MTiJΟwMUv4~)/LZR^\No?uUiJ2N3j)E4ji2a-[̮:m1j,'GInҞJ2*#653ڍe^CHeGt-MF5:֮drNUuJ jnu6v>k' 8u&vsZf{V?IV(Rķ jk9;t.ǂQN3u!|ڔ-sڗ:[$/$uelud>U0MWJƔcY"eԳ7bVQWW2#2V2_nPb;D2OLSslV[k! 1d9lS6KRofmv-Ǡ-.z}Vq|Y/Gs]5}mηWm"ƃe%UQW$ܷ:3^?fe˴a۴M-K3{d5R2ђ3I̿5ݹ5w)ZY;_h첛u‰ l0ډ.tVVzp$<!ï!zƷ+N㪧a94Lߦmȶ} o"z}Qmjw%\b* ^WeoW&p_Qon)I&8)e OmE8.r =Ͽ b4).F\ ]^6CUu rxĬ1: xi5㕄'S(&^eֶ%&N CZwR#D`Xȝ4}hV2mืƍZmʜNLǒNP|qdQ;&C50;8׵)b)j$.$2|}}gݵm\.%H6(3EA3S5ƉfOE7iHf(S1;dfnIݬH:Jm7 ~vF[{Rưܹ/o{ic3(%Rv+U^RA+KttOKta鶕/?>?K; TO]yr|i_iؗ{|dz,qoxvӜm+[ms )=evJ99.qNǦ} iIJmCZ)R@*|7$(Qݕ.TUi㒖CUga)B ߸"Lxl=.cŋ"LPx춟;IJRDf(Ȉ# 7qNEY:Èyn6d~:s%޿;UVON4 ׶j-w)s0|{q2;dnRq.\הJ޽qڳj-CX=F9{J+X+KuƜBl㑬z(0:ZQ{<%=*rsdjf*} s3󺹠ؓXv.ߧE#<讽ȷe>NKRن`[BrwHeimIFI}d^[.I ߵi.%4&B ۇQ&VFhe3,6Iwrn Q%&Ddd]Lv:æidݷ8jpaq$})e3.cAx_0i,2k=DyU |:HJI'ꌈ`+=yۈh19nB6n=!Vϡ$cQRR3JJWQ"hۓG闔8|}U"skkr&a=\`ǹ%z p7 9G*ό,ܟZGmlEϢ5B'Iv)%&/<_` xH_m1v۲J*X}B7T_ԱCA$JrS͡$df#3}ʺUeO5MVnޝ;vŴ.ȥHvܺOEzYYl<ʋDXpc>RVqJ蔤dC9jpjN5LCnHdǜgоhwש"23nE&^)>#Hu6ϕ/G?HgGFly\1|좏p`_GnXJ9or~Vp؏Cp BIƔҒz$iq.$']'mmoIu~&LQg{ATߞHT?wGdKNߙ۞+>2uvԹ|ET+Nj&Ӎ3iYsr_9E.UӏkoƜ[;=XGE=iڜ̊b0% my[\H̜6\QWckm}0LWml'ؚ3uVV3mAuhߊE6tz,D.!eaxy~L30J:EO94-SXysM4k>bcY폥)uk=O]#a+)dƘn[OŔѩei-N'j7@홣uOexvjԣT޹2,'ǡL\ &j6`]-5(־CDtjK"y[Td57Et_/S.bykRԥJZ֣R֣35SRLLee)$RP$)""EЈC`x /'tNrѿH_6GkGӃ'y;EY#sؓYB vYzKGӏaB}Q%m$jR"JHۢZKhm*R֥P$Zԯ"/3_r̓ch+ +_QhXIL읉i>!Zz; $ۑ.ꅍ3'Z$!(yɿ-?+NOIOtٳGUvsǃHΜxɵ*qZ&SrN9+gJg"=A_jË/^_͎- -t; )*`{c6Ix R\*E%!+:2ȖY";Yܳ數 8>2mӲݶ^/m9vܟZJ)N']͹yo"Ȭ X6-0p+LƵF5fYȤ~LJV[)3(F;?e1gXӯ ^ďu}O Kxt"E]<}g}^ zC/Y/>~@=G5/e^Pl|ANyqC#ש| zwO}^=<c3o™ձm}6y'{'i]=(.5De'օ,I})Ӗf|׫m\zQUx[i`3_Ud~>+j"5ټRjo3JE'97-+6:^:ٙJeQUODѮ,.BŬ'{.n?lM'BhQC}U͈IztQl;#z[6+IN~jO{ȡƻojf=\˳{:Һ)qܴaI茲ͺz|P@ !^Womw,к>KdR2Xkb^GS"TFDRGD;W\kk}_>ý&u?pZ6JI^N2iVVjI4fG/yqsOOvsO+ dFjM4yĦI{'$[-%J5Eʎm 8'r\WښrF>s\,p^-f+ε@HU!v⛧do.2\UtoT6[>7vݳ^[i.|Gk{/}'l>5Wr3. ;^kW+f5ΰek6J'J$IBvOi' ~N8 Dcc0Y!dQ[EW%#XWf~9i>q]az*KOXJfeRdk2jk=OSRIĜ/rھw`(MKɯMBU BOmlȮߔq_4P1-uE#;^q{O~w.ܙ.ĕ,qTFLn2Q:Br/ih4w36N:byjg !&4ۭ%U'GDfګm2˔fqbsRR$"`,9ʎxj4~F=\Xʮ9U1+7VSmlQPvݶ\8l^a&h7\9iilp'4zTjX[C[Y0Dt/楗MwO8DfB}ZТgp؏Uj;?'QſTlEm̙pK̵W؛T]snpYp|"2t V$Ɵke>eȇ!__^ʂڌ)}S4O_0!74+y}J/ JSJR|K]H̽cI9)F.>SNC,I\7e晔hqq]qKrۄiQ̔Df]@>~Ĭ#3i3 ,±,nV)zi]7jw8r"TVEdqP{{~m,=jJT9).֩U'sW՝ӽn۷8#FԽJr$E4;|S1,>ƸuSnl*-l ^mxR?xT9oM !no!)5OhJAjoFL?;MJ*Z;Ӣ)zKR i6;Kq^tKW-O&%ZB2^ѿBIwgŗZ_n4ͷ9l,I \\d魗HQyIh%]K1; v]uM>oLX.(붠mu^EiQC&VJIxݭ,NJfLi W-$ $~JUpţ^![]Q{p-55AdYD/3zGȽ3O5K@3<7~Ev.'g_^NSU ["}"Xm8DGշm- "Q}cedadG+rrQti`bjXͶ[itҗETp5Y7ue덍NE%`S1̷ۉs\@4Y$gIqI{9 :ٚ6|]rka=딼Ҋ.kkk]q?Sʕ0DI%xuwTƴjk^CdO.2)E6)7K&6|U<^-y*#29Z6, zJi{"7 k2Z͒5!~9K.lfl{dx&֏k[٥&B>Tv"U. cqˏF+Naŧ>s]0P/g?ړc<jS鿺b:63C#O}:;vñ{Dݹ$BAg'Mu'RC^"#fԭ՞j4kk3=/[GM:uqu|o+ ^?bu֩@#0&ܶ?#nFITmMFgj¨bN;a8&Äm[#O/; 6eyIs-e03܎3^vJә+*2/PDIJRIJH<}xča>IIs8^&\B3 Jt\_'8Ei$eZUm=~zqa)FQ+X3~YȔZ:RMu/Xae=];OsZޓ l#HД^Ԍ%~xw9_d#)U;LWS_Iᙙm><撥{aUj~=N4u4D+e-13,CNrԒS. ;.VIJ&y)/b[7=?6IF5K:S,"]LӞ!nRZT-/6cjmm.M+wGTkui^3ǿrm9;]/icj*;}Fn,͑5;F*>z!"K} MWDDwV{-(m47bܟAݤ갼5'Rv4! i6m';/"k_T#=[SN-GKXrgOl=uK#ATi{L K~i[u JB9V-iiWB®efU:kf5Śj\[^}3lٳm[DŽaĨdef]wJl')?}b8^PBŰdԃ'y;EY#sؓYB  t˟>ASTq3;?), LzŶ5-)]z_#iDdeB1u \n]VK?y{ѯ$Nh/[\UK~⚭S (Iw@9{zl Zw%9^Wnҵ6a uH)ؾ$j"?H7vC}ku\S:n:8j331f*PJ. %ؒGXG +-ljEI 1L ДB/_ATSáu?xxu/o1@=NEoG.n:O@Ծok޿m@?"E? 'SEC>O>X5: O>}^_W@á G4?W?W7 4doG|Udˍw)j9-iY(؎ :O%ܜu|]~SKU$#1z.5%Iw__*{< &8dî%@//vuV(0f9̆HB:xtRk9=Y8InYXg71M q򮦦3s|) vd=e~ 1ͱa]tf.OJ^ؼ[;^V,SUEVR}6R0N7i]u*0EdyS5Km.}֮zD' rd(\y TCEl:_U i1pM?` Y7ȧ]ʳr}ff4Sr5mF;r~EQ%o.e7<¼\i*63#N=͞盯=ϯ[uVLl{R1)*Q(?/"TH?.|+Ǒ:[j%um|uLZay$t# ܒdm/ݻ 6v}UKޫتR%][kp*b'2Z+!z\Zzִό7.smxt @jye T."2JJUƟ:y,%q[Šl5wmqJiVFs2R7Kr.snir­E=;}x 4X{ylSr{Zʮ)$T%ZV""FCRyּg LxU.KHwTxگq$;7,uٞ rHTk:c̤:mA{VPelmsKe/R}/L_OyNլ긯/\W|JKEsSߜ\de,y19mU hNj4z(BYNI''ZC}ܢu1LhZl,nqO6dLO :+Iܖ RMt쭛pfROݨ׵5IƊrd7W񷮓I[*pdnT3rAӑOn2Qvt5>iQ]% q$2E oVY&:4+[k$$LL5n2}9k;kF+7mMwkmq_9Sqmǩ o7ݖXj#V^׵9[qe.Eo윾W\ MiuE[q&.) Oŧݷ8`r#;+kEjI ES|FL.\/9D5h2f=9M7 XaOgZ(^3g^Y%cyUWܝqdWWcome--j?GB""",͋XbTaRIpH߹vY4ߧ\J. P uƼƩp35[Gbsu4tu"C1iZm%В!GD p&5z=DM9WyM6Vʑ(i%Vo<(ȌOZÒ55z(zӅr/1AFۣGތ}Tlrko/4ڭ.t[bMQsm}IeҴE"{f3WCN0dF_CTwa~$e՗ 22?@mWn% Wm:I4S(aDؑN%M%:"WCIGzu#'Wz=_@t//0 =OGGE ??=@f~?OO }~NӯSziǯp/WAN~Rj7ӯ-ӎMgJPDfB\Wj9rQNsR߁*46\.Cc8.M4ꥸII QN5@] hI*7IWj# o<')jL̮v겦rEvN|%Sܚ6sQȅ$rrO)pDۡqZ+<ƒ^7nFmy(uklܦ#h#mQ&JU7Y~Ʒ'#n7ُ6&MOʕyyeGҦzH+<N6I-E#G:Y#4O%5dg/@-vRO9ΎU"U\X\Q\o%?y$Oνu)!}趋 ;}p4ynlziS4`dM:Aq%#StԌ&۸ld"Lx#Kۓ)%Z>3,m_ uʠXo wrN"nrV5n%^S%_[4ŴfIY"MԔRQaczיܙu7&&Ƌ%+CԖl[Ȯ5T.5Z~RHD3 FҒZv5Mwo:5 ˯?.ȿqR4ޙМbŋ1}XOlcg$3*FW-lQ!JvZ~N^-]v` /'tNrѿH_6GkGՃ'y;EY#sؓYB 7=+viιcٓ}S5g8!64Z!*QLBDEQ+#痭7V/6"v8\no=Mv5ʔRKy|K|W ;=S7]4܄ϣͶtc/"$C5>?6}O>?1᧧><>Rs@Q{ =~oX7tx5/Az?ׯR)vbDG*|`:K}H^L[Qi^gEٍib|]i±OSw-jS8N#9.*Z}G%ʣ)fld8fD^vQ(d Y }|-.U[ӒpvM 1"nN+ibY]SGιZ,?Z.~/ՋZS'n2ᾸZ]w\S\)ԗCP`ZXMɢfʅ7Pd] e3q+acd6^fj:x|K 6@x{I/ ySavc8ԓ8m*,n4xԏC3ޗ鰦 /kq#Hy;ߊ>j.S=U.J*>hjUp{D]ZƣuW[Y1Zpm>xE-0ɿ[O5ƼAl:wAxᵻr}s ^բcW)Ο[ϥe\Y{:c}ȍqym]qsk*"ۏ1ډfK?F6gCsEIoi?̜[M}xQhɭylom1d)_@DO&nCϥqt4[knyXVsܫ0Rc^ǕƖ"4G,Mˉ3e]}jE=ȸfonhvJ.Rv\ܚ_6i\ ?Vw)ꫮ/M^^g:"AK*>Tkܬ{v#T?\kgGU§Zt7l,)~`R6%rP"vk1` "z;6^b?J""gJ%=%Q7OGLJc31ۏO71>k,7c"v4OD;#&m1)W*)+NL7/QB.FArPo lxCݻo3>lUG)ܵ{η`8*M^_ommH?Msl7DUϧE.̍_'lWlm/JXUa)K~ /ݕb\j"?a+31_Qm}w%/ &FgWupO2/trIVWlG'g]uj/|.'|ƾw*m7'0>w$l$B:~eN:ڏv)T^V]y8:3I8coSɰo_u/unŌ{Pso6R)h[,IRJX]3I_OK.+:3,w} J^W<;u}|/rܟq_Ü|bR*o?Gn騏4~m= |1C\d%o3ome 4}"kiϜzV`d/u??. Ue<؏I ,.U?[d>)p\`ZcJ{iHmEД_ dOD'Mib%/[\,Xnm{Qx,+H:R1mS^6F0p Iq IVO_evcRÃi㯏GP-uFA5J[JM{fM7e|s  6]Xmܙ=mƬvSd34Bz&I3#5݄{T;I'M.l-\QkYe)F1P\]z Bw'vn9Imř; :,7}tfaZ,dВJ"/A0p|W1?sw?&˖F8_?փ'y;EY#sؓYB opmazlβw hƗ-{ikPd^= CX;xFr~U_GcfUK_ɨέgy /۹6*1nl&%)^VYZ%&gӡPQYjqe,n㩴'{Ez~']w;6u29MmYXunjHz#LJdlݲNcnMmK]r^} 8A(nJ#D']utk=zOB]:uӡNE;( :O>xzzO=xt'_..@ړdfQ>%Ǫ}BSjrTQFJ"Rz*"WRQy=smrk<'Y*aTRS`vMMXhQzm GyE9fHjv7UN}|_UFﮗk9.<˄JF_IF+rӂ&nzGmU0=wZ'lOy#嶛U=*Jg:%e)!1P10Jy=rڟ_댣2/S^&PL{E{G%=YJ{4=K82byRis;HZF-JDJӋMUײ=]&BX<04>Iɶvw\"blk"q2ڥXŷu^RmDM!fsd9GӇp:o1ǑOw1C֫|4ˡrRg,M"j^{z`F>hZ-Wm&ܤҔNg1yCW[%ijۙJ 0uPRk\Qvc"BKR)Kgq>OŰ!\s;S4xa䬍meV?|%o&dFG>g&BrˋI|yF_+Kq t놦啇.ݗ?V 柚%<=bQ#+ (RydLGv.R Q =k!a3!1@'1{N=k|6nIv 웶d/: ֒NgZ HQTd)d˱<\[/%G] yϖ)bꪻ׊k:>XvיTrLcbwNaC9MV=H*JQɫDZ_  m6chTj3n'.**\Z3}\[]t|`X6%jbrW>[ 3d绾V;S[q6GEa܂̭6;=!v ǰ?IRָ-kqkZ֥jR(Է)JRLLIHxQB[JP)JI)JKʔ>xz| /'tNrѿH_6GkG׃'y;EY#sؓYB K;;U 16~lc v<>xj̘e/N@BzzsxdKk]iRWj?2j7n [}]ߜjkANqFJC#}qP R`~?<ׯp!??Tz}f>^#}( "Qp|s!OS ǯ_D*OG^>bH%|O z'_:z:>z~5ޞu@^_@ӧNW_~_n_\C6N*C]~CF_k1v6M'd}.q{ +im2T؈:O|QHϨ̳s sIJ5F:w40̝J9GIJngN2cX.sMcZf['ZQ7=U5/*ʰ kfcM'ǝkB}$^1_R;gN6-hm5-j$ x%QIUYqg'Kyyi$!>u|l5M_qg_aIR!hk#WRUOCF" ؚWԕ%8}j?Yn컔VZzs|8qzv(Nq絗1d 6\xfFG*4ZR1 E 'rNB+ )N[N+4^C JR$8&A>Piױ75'q}NĹ<q J|Wg5)895|iOgPg<}C/cq_pƬK+1ѹ]E~ߚr'Hq<ƾuxGI;KdRͦ걭>ȯI'YUUhc Y1YVs*Ŵ4SqcNݨNX7wYt`U8ǻilUp?nqRSyNn: -C006 U߆M\nM9V^TWc]L)eݝ6;#{?R03x}FmYxܔjȦ#C5{rDy9zU^E>8Tĥ1qWn=oԟʾ-z-cb'ڛDf߫22pψpb9k~O~M-􍿕dq?/$Ѓ'y;EY#sؓYB E{Hea̸?td|הθEɭ/e1}K^ݯnM-cϓwi_wj[b&kK&ֱb2(q#Wr}(Y)+ZzT>PEsFS (_5|??T_;. O|:x@4<@~'|}@꟔tx}p>Dк|>oOGOGL=<=O~AO9CUx|CA zq }}GBx_~6u~+L ]|~o_Ec5o@h2?fNAlo_4(ri^fN55$Nuْ b܋n3l5tuL Kɺ9Rּ}ʝʗ[lWT팺-dϲidJk󶮄=$hN!Iۨ\i!+Ф(RNKV2UOp:KO49\me#>v$+џG ڈ2#zt~ؗ}^~>R@WC//LNצкcn<3K5q8Pz~SadDFgvtoC_=٭gZt8[)I7J&)ÉTtf^Ҝ|`Zo DI˲HFc֪dZ~ȼr2ɲ, UݾIw5ER,~.<~> 6jڤbK%Dhro"IOտ N)AGPL c̀#r\wy@u6qgxuvѻpN`/2jdON IFRboMyNZB6;W:UwSZ_ݡuCRהFUq?uq{^.NNߦUƝR}:cxNZ%*7GG%DRbAz>7gC)G[;ȴ%y!RQDD*ev[^PU(X!Y@uWXn>X[E9Nĝ>R5fK?gR\ӌ|تUAܓ^xR#3[OdRDn #_xs$Ξ).Z7+0_Hу'y;EY#sؓYB Zi "_nL䤖=QTbR#dhqȌTSfDxΆ̻.K|=߼f:0oy.EXs^^J9֮b^kp1E iׯǧO }y|kO}]| EC4?7Ff^_w;PztWO*/GOGOׯ gժkc3p5xȍ :(rز L-ƞƔAcKǭ]^=/ 87Ŧa`軱;RnDŽV_t:%Hٔyێ͚UW-.,)ْpWYJY>ν yԒyJR+ן%|ߕMLҷGmr `rʩA%Kx#T=yf NM*L-wͨa.2j)>JM/2{Z [<ױo}1λȩ j}_n 6,T3øOay]j(\YgUMVU [v6Ϣ m2n6yl7.$nLYq_OPjm֖^-ڔLGҌ'*5ڟjI2dE\ԓ\0vJK+CɃ%Sa蓫?,0dG:K?$n?GN/rnO>w=rLD9)W ,,1<}yʖ+Eu|7O.g#tMn\cnSsKԏ:pv#%ϓ83kE҉|4|z=ƣdDgڳ/!;9f\ w'۹H"Y(ة&f:fhs#au2e\fL|j{r٥$I)ď5ubX[ vn+Ovۍ]"n βURg'E'k>p;^ګ0!_^l˃g١-8 nWGY2nYƂ[#I쪧)sYd6S\JZǬe y]ehq=R10eXŷ݊_J]ρWۺ~R2qtt}Ů1}馻I齷Q^c!׻W 3:;3qje+E3܈A NۭPkZq"~ЊHn HލZ6aR]u%qWKOŞ;˖J/վ[nJdUN=1Rk:^,^h[#';Kk5'BWIQs,py^345#!QYdc>sxlhx^ ̞Y֕gzKT#?Mz'k&6 ]nQ^; |F8L=YߴQ[{$#8j>IJcĬ˖]m֚.R-et:Ԣ?1<'-pWGu[2^bvtnOAK,Fkj/YnM{U6Md\ƹQ~[O98EWcXYI Ru9PkЋzz>_G9^C6W;@8 ^z_/*=?[:}KԞez?? zS}dW.:fjuIȔʔ־"I~/%(s\i/|_d{Y~v%*ul7KQPQuP>mr_C)mKu̫ }}PQ%#RfIhת'Kͫ%<,Y>*s9Roõ}kPn^t"$j(^"IŐVܽ=ץŽήW-1m)*'E^[]{}VO^7[h̛vy2 OCu.iIZVZr"4~DrȌG^߹=~$Öݶϭސ&>շΩcmI_}d~buͲteU[Tux}W ݩ%Umը׃~ut%=(s3cM\navVmNРl㵓ԺٜLdRM* )g2?x0K{%y^H³Z]iQȊ֗Z QsY)1{ޟŸT6AZfŽv5(©?:U?}pudKnyJOΨߙlQ2,ZO!?)+DGLMei;7iz-A+*3Zi8T|(fOl %Sc$%q(T^b'T^~iGWs-zƸzW,#$tp's7_oM.8mua2rM>eǑxDi+F( HIJ p۸ڶ@or?kzfyqS{:םr^=Ipe;6FUnr燭ze?(.ύ-^\ZrͥYQKmwOg!t]s6, mm}bq"%\wj^$mKq&] o)+㝸UKgSNo7IƫVz3 >sI$8#rJ.I?~~O֊i:˷|;/PŽ$ZV/QJ{Y߅?(ufFojouJnM5U "3RT^Uc$G0G%qט̻~qLJ$f1)Rf[M]G*atFҥ'0FbN_xs$Ξ).Z7+0_HӃ'y;EY#sؓYB ORt:c􋜇~M}5"kGO_y|||Sޫy:q=m_F|9^^_zJֈ;Pƍ&Xw1ȗ~U!o<=g|KGG:>oǧ}@^$^zuQqOCiS!xtF~5OOt0kG5~4}]zzH5|}^lȼzޟX7tμ}z]OOsR/OĈT8ĽǢЀӧ_]=X_xd#]f1VFU]H(7׹kuwk%؋p=$j2#fܛb.s%v7D6p񧗐 iO.%%Iq̗2/ ǭr3iq7`]^Kd6?G)ri7% Rg}M̼(՜z}+ĨTVSPK~8P)pY$܍0#0S%3[Caid7MɪmS3ip53z#T93J[R]|OxU|jQ\={AvƱ}n2 {+MKNi9d*"dO6Giq4GL~FD@_wݻ&Ӗ8U{KSJ؛RdYlKc̷j`~vm-n L+&5xIvYږY|xV_ $eGJԢb;{.~ݵ.Cr]έڔQ'>}>SIIp,Ug?V$6o7[TQS`ܫukl(K@r$,Ʃ H8wqRr%[nFk{OXܼ(ڜSqWEG/+h {7cnp^&/ *~ (j˾ *.>|K훖Vgbljw]bb%KGdȎsɫ)IFęK2'!.9]MȻh;sge9t('ȺzUƒ3Pjڇ % 4zNcNfUkڛI֗'EEU@یέ0UHd֤YTTE*Tՙ|OĴxn'?-4\O/ǹ,9Huh25)Zk>-. ڻ |UMѥc}M;ۄr5\ۗ<|aD]{S z >BcMJ" "Nүj#h%$BRc[`md\ ȮƮC0SM2FRt=.OL+x?䟹;eF#o|} ԃ'y;EY#sؓYB >@ē򳊖3ݍ})<6. כ(eHyItQpXtp?̓薭XhǻJ3.H/K/ůǙ^ vP.7f½d+RdQI=\q$jZ^T|_P!7=~_ONkzt=~'_/Qg/Qt/1z=f _ks'Se?tO__d~G_Azz}d^@ :z>%:Pa/NE9E>G /7C=0i#JH$MqnXU|؞*#e0xr6a\tжq}^&Mc[~覆tdQ Nx;]Z%8kIJIA ΂[r,qM;R2\B,wSLum8m-&gӧCTFq)]ɲ alZ~ʙۜb?^cVȁ5x!E>gf+RjJ:Iv5^ƻj*ڿ؜ڬd(5Xpik1o%Eb2(MiȺyK!Ȃh\sytFJr,9ܬaƪ'+rFp4;omspS4[9+V˼28'Л#%%d023L /'tNrѿH_6GkGՃ'y;EY#sؓYB B;\r|3Ik+sO MT6+6^&VnkF(1V[l~}FNԹnw*4#Ѹt;3xoN*6 !9Nn8i&z|fY###2?SDycYVϋ®" də]g lam) ICn[IEMpk֧ viMNFyF=|[Wʧ:j–bn,Y>4gb^ďнWCG&ѧ3}'G>OG@m_Sr~? p#ԈK/=<|?^z@O~' =^'кvXϧb/Y^t kؗ^=Ptܷ^݂T,Z1Gk&1ÑeU$%d)Jy EL|NoݕuIrIǙ'T;us4ZWU̸jNlt[H`ëȧk$,* ;lVLINGfIoyI;Za4tzǂQŢOP!BJHDs;.v3| ſVW![bZKRȵke-kY5=csdg3Rr-!2qGjkԸ!dJ.gj̼=dd~1ڷUm_rs9(܅{{5rzC}1!A+̇K*4yTYYgc9 ̙$mA1,q^DRȺyM1B.^7^3Vmz$ēT-9ie,+1 Rٯ< wtm|yi#UvQvDBb؋U٭Hu1ڜORRQ JbcpX$jGl'd!%^2No[ts%_EaJ|!ҭ)7YBw?`F;vF#!"f_ 9a3qe']#OvҹlwSI"iZb.R2l^{yrMumE)EjE?9%e}#Zw5UeaζVJî8Lkz~DbNJt~%,qdJu'#;f~O@?93hSw]]]\D+utB"_SլNz gꤟzޚ# Ϣz6LmiY̓eN S'>iǕ:& >OrlyAݫ,I#c;h6= e,P)q`̯8EJT^ٗ[Z8BbHG֙޿6>7ak`W;0)Q1+<չS!5fUY!ēKy3'TWNY6!zӚW.)8F媪a۷w}9Z(r\Toj+,Mb%3z f-UYrǨx* 1|m(u/O$_/68=G%8lŶi쒪yz%De$n6:·WvQ՞q5'iMF?RoQji/~Jƽy Ed-PdzŗHT{pdD}Hi4sW{;`6_z ^*RDzzؙ{9+ݛ%9%~dC]:|&rMVN_f#@X6bK\KUӔNMس^&kv`qv9%o -VaHt&iT$Ɇ|z37e~wfℒ\ٙqU`i#[7`WZô6)Q'jlG4u}'Tçzȃ{JQ^33ϙD_5~RܚN~RiQ.&{^WhWECܪ8)x_1uNn4n-JC"KEaefH_<rOɲ~l>dփ'y;EY#sؓYB w(/"x(7kWDq"uqw봃4̟vvʘAp@do]nꖓkĚSNw-:s_2ft[uMfŸ5 wdJ5.v%N+i~;s9} wܥ,6ҵ[_G7gj4u.PԢxJTԃy_A쌾NWNH*?qOR?>O>@Ԍ j?'_ :u/~|?Gc.z|/\'/}o|~_z:C?4Nr* ?s 9aY^WY,Ʊn/g9Yux.2V,^ɽ k1rJ1Kɺ%ﲖVM)J\HCofͩ %;d_bUJQxrDx|K3l]pcYTT:{M>{)rϼ&0_`fۿI7:Džra,ոlIs6x?W|E.?'W_(U8O_)3s |z$}KT8D}|Lׯ ~%g?>>>#7x.t^/(SgPOG򫨨p/>9?':i4RjY T hKUIZ4טNG>35tonI3J ͽs;UzDUJTTO|Hk~?'lmG %%os#1^8|2Ff\UTtOICUK>{)ifl̉8Hj>~DqK+{7O)̲ Xp* ȲM}jh4~VsFSUO{̹iܔҵιdd%d >0qYkFpvCsZfȪ-لhO02yʾgs=ȬgomնؙgKrN16./iKYCH5+Ȃb&&j6!I*|>)2&?1 >#I*t\wx~Toi^1RI_ǣ Q[c]f 7fo/ZeK'j].>`Í!7[JtgZ\n[Q D~$$VXpu F4F4sԜ3*+c>1>97h6rTR"Kh綴ˮ6sIճt]B 'w8k.-i\%U}QH9+yH蜢[1܂J )Ɲ995:j#5!~Rp}5!]GNזړjlWz֙_!dc U7# Ȇ^-c5I&4sPĞƳrv|a'֯ϩכGZF KnKRU>aC!R%/c!GW S\ -,α rYk"oZqZ:y+֡~]UӋ^_"&M\%jQb_es.*3lS&r]]qR*̔[.$RԼFJ{bu}7.XKXW$j*mΦFٖ ĒR"uw\AyTk4 wh\-g%OYeyn ik,s״**^;7}S3MꙓdW [V%\Tcg6#@"6%E_`·!YDSo**)LGeuytz]'rk)|g]UؽU~FnPxFoii^X8wqw~#b'kom>?Y#M0]񕸹L"ʭ+!+ KTOG+wI}Di5IRLҤM*JRM'F]:DF*BЗ[Z*mKBZzhR| C/eǯzr <}_8^= t/>ԉ?zנzjO˧T8H5x|O}r#| 'LCt |:x=: xtB_'o-缏!GȬj=x#}CYNu_lp[&_}5 ;̍մG}ˬCLaKmgio gku+g`o.ry]v{K1+ewbDRO[rK 9$U$Fe5Mێ|yyLdl;ome5Rf:H 6]6N0aABեH/ŷžfꚞnsQ&v~ x$%=LOŭ3aZY(qI-R'Yxٖ ϩNȐ8ZV8q{v-wYmW)Zsׁٹ0좹5?QJĆ5tϭ^$UehzꞗN_|&>m(~\KrFN21'nr*]l(rZvפ>ƳN66F'd\%󈔗ԅ|(%\!.GyƗ2_^S/^F5#=suJ*SUO>yXĒqLL̆(ڐ8[nCJC<C%ˏrTPmNd }VN$3?BWk۱7[ۗ;`WʿzF꾊7mѮ) 5>#)e1dy6HaͷyҤ)&iRTFFFdez )+ŝJ)َsjv lMwLm3詳+Qzn6N*BWfѻ3SmMBW(t\IG$y81}O?cUQJ]DH*ucl,FBCPcٜXa73"2#&,piԺW}O_\G +zz^~}oz?z:sD~k}C<xtzAyKzh'=eӨp'="Vs-.c-G:-qI*\yPx 9&;j_MMwRU+KJƋ|]غx~WJ,s\j . [6 Fݕ[CRF(?%LDki=p~2cܺc5w/%Ako6~rjzxʰ]x@w6Ouŕ\|RkAgLvHSaOTiDJ_v+m!Nv{R,wvf,u;gyU&]Tve: Ax2NEvTKrRI?q 2f+=+c[-*EqdI&?-v#!8?qLw2MVTZ;2JX*F%eo!9/k6||<؆Κz^ Ǐl_[䶂6:\vdu/_B. pf] 2|߲___7=O <=GJ. KČ}_DeW_.b?HsOQwG@*W}NE?3s@ [-dF;/J:kȍ (LӤdaלQ! 5 %&V$[}r`M1ܻO+SMD2dWG\+K+ (YUY RjVXٻ^OVYɧF6;n+ i7G֚Q%V1qRr=:#TyXkfhoOMbc:h (ꗧ.t!$Xr[y뉛Vބg83>5{6J3"=lF3ΩQ_}m^Օ&7XU_NI/yKZqX?,t'(`4V9luRWthSʡ6ңOU&CQPT˩u) %{7P_Om*BVE)'̽Rnc:}Q}{")̩o4N Ny_HhMں-dI22#jO'g]~cHi`ekV$E3Mu(.pޣk&[Bˮ)nizkxz4ߨf[kq\!訕_ܹ[M$!(&Sӯp3+|@h!B}&eDŒg=``&d.O+;8/}Vê/v,%{kUJ[J2%f9un:I#/07BVU/ٺ踸sys^$}* e%_v=1=[p' .Z."ޓҴ.]q|Oz;10i94iRO.\u~b ^ÌR#P}\:xslhߤm#~Y#Ӄ'y;EY#sؓYB  !x?1sɣ,yNշ^o+dKB\R"UǓز\[*m&|rN3첟ox%_FL}9F gX5q84Tr\+]K>} -rz ڔ/GIXK:':r3V"6JM?LjL3S[uŭ~CR3JR^m$II"""C\(%Ǹ+M!^o#h$q^_7tԵ*ZjQ5~ReLS6#>ǡԓ^%}@t K6=%_8//@<^ïPk>^`l?GNОCt ewv:{06ךYWEulI`aV-fJB69)&F^Ďnõ5U J8/0f\ٷKN\jۧOO싩an~<6,pWY+Y l&){b&[M*SDG/Ɨ ;-ܧ\bv&%!hvA3 鬁^rP"R}_3g/xWB>CF=zvg/r~$tXzVnMdV Ѣn}:C/ƯSa#"2?cx4;=8J'>݆ѯUc7#*ּR ӑT6VR9+23lmwRE-U~LW]}&8ٍr,qrUUo4F[&s_d-frFf]}h풍}IpXͩ璂RkXO1աMв4&iRTFJJTG2sMP]xɷFRH6CqV.bZWic?J>Ա~np؜~u.z6wz6Ɩ.nFI{($,}ǽ㤤֥:2qe(V%o]P]|Q1y++ܙ±%`ww.dxbI7e}_5d(ho?G˓n<ݟ*MpU$рśHy'ŝ'VV7}XdY6?oHo`T78Uxy4^T^-<\t` /'tNrѿH_6GkGԃ'y;EY#sؓYB ~g3v]]FIkC& `ߴڛv٥Qcy 5LV~Rq"͇IFw >\%n ӭ" &J.ַ-C=WUσUFkԢ_^q3.=+%o;9m5>le9S)KQǯɸ ~=:i|:S<>N#pO—s.z/T =Gx|yH`C/O_}> K'8xd[G1v ©XjcHfDf6!2d(b7J(UAۺxd+.tb*|hsrn#lb}+Si(*9kUs8] x[=[|Y ׫?yjU[cTM}֐aBi=[e-j}򧞼a]:/&g>s[%Yy[fC7PV4] KFj2g{/7&sɷfs,#(ŵMVos>=Ѓ朔ڏRQ5;DWw^#j ׼q/mlw ߼{(]\`*O6fJe2$La)eMIU]| ~klI &km! 3.̒32#9lWnj ZenB`BTD`9O^ J+LlO?q\}lɯvMG>u;b]iYᶉ!|-߹a$7immc?qj2 6F2ahp:FF<zSI#2K ۰L\gnOXg;^ݛ=Hj2zG,.EKIQrn˰;R%Žb4[0<lqIJ*DΣ*ݧjNGyu:{l?w*N㻏[.a…PLШ\z*dFJlȌL,)麅>ƱrP%{ԧݣZԴ~%FKti8ѺM<~w^\{S77hfy-uRï^e61'!dfJKĤi2QԶ^q/0o4q# :3SM5RQ͍"{Hv34}ey˪L˩xG}!Fp[T^dlGeW{'!E$5gPٰLB#Hڍ=omٽq\IkV{H^o[Â_n Ԛ샏zzv(4eUp'fT ,2mmtY4J_ڛUaf&f(Ή`M{sqSWˮ%%(re肓njNjqbcQ'rIėi3qv~+7ʼ!vcܕ+6U)Z^'қbn/ߩd<+ \я3 }C+ ]woF;hGmNxt0dpX8{ /'tNrѿH_6GkGՃ'y;EY#sؓYB ρO2>O >&i|~Ex|:zK)E@^AP |xu%yi&c*^xK;rW vCAv#aOuelƣdwT}&pִYkq1>[u_w{{dfI ڭaO1awtFNjWfvCҴ~Kpd''DZeY=KP*F5kܫܛmzq7/q6|aOJ!M\bwuzHCWVn-""$2 $d*Bo1\+X)+b='ŃOD|H ,(g۽e^W!+!$q0̇`ê_зu/W* 9{rtsWvx~,S+|MPy|Mm=5f.⪮n.+ʽSG8X/M{壢W"EzZϧFԣ3$HNXjKDwJ+T厨 ?Զlesbj6NI;\⚫+_R_ fesWCȜjȱMO+mvL)XO) W)i61f}%k7^Es yw~>A]Ԋa\0nenpII!'Xi:Ԛ2)O[ZnȒ!~ /Ik5,Ïwze\Ss-!T4J!K 1̣B\t`}\:xslhߤm#~Y#փ'y;EY#sؓYB p {'{VLAK1{*XjyL明Mh[BhȤǴMqM'[mIkf.`f%8KY%Xx8?cei.n#|SK)%(IIqH>xXDmge ͒ }*$K#7! I6͵*|Y%dO8%RWCq=$4\qn2|>ޏAq]ǜeT~*F.ѵU 21';y&tJhGO2ZY-=Ķ"/XN-Eɾ>.޳i7rJe]XV\FqsފqWkh>2r Niؙ-Wr2 -Ge2d堔J~DGY~3עGHkK ~;Wk=sp zz b$niJvD4vZIR]2Cm65̒FDFbjV_q;r|U_if"lIԆÃٓydxP!Fϼ,SRP5n]yΟzg4 M3+Do~jJZ$tJ6=Gύ2r);pmOCN繵F̫mI׊t_┨zgv/BhDM>2.[XNnI[2 $Ir .!=KuOsKnEE 6l8DIH#/<\;jv7WlZluySJk4™5ya:+7rF脱PGo<A/$MTKDž}_?dɨ׋e"!;7qEQ{?#LR~p$ڭ(JUw:R58F.'+6ڕ\xJ\yFzWp/;Z;+a̵~)\Cb5^V&M %Vߡ#̙$ Qf}!Čѽ"LPm&j$̈P/e>WkqK<1)UCd:>y7MI2Q7.XVM/-qfvݚr(E.f5nS-ϵ&Sl>_k;L5{LGy3-zŌx0LHi(wʇ1k~S'GsE sʽ99k]RKrv"ǂvPD:E5O-/EI-k:Ż⻑r_t[}ҽ8=cI]˔9,´׉uA~# ?W5kH_sk整]EZ<Q`Le4.E`ds&j9#Ƣ3IPE?*S~fݐhhF2d}h2yۻ7?$_1~p}ҡH0\y-kaRkqn)6e9>$HZvsc^XFƭmMMYk=IA>/+G,a9l"~%ɔRClhr-Հ$r):Ý^DZNjz Y_غϞm'}R^&D#>iLۋ: Ěȟ/\--:oʃ=xp.j(7kޕ0=!עf?}s;ZϡaٕV.̥R9>aF{{q9cxF,&uD*KHC#6ٜ]11?=^q帼m˄wHwǷ09[t(տUU.w)$i 䴗#a{$vm3A-ʮ/#>r(/VWt9[6–;l*ꥮ l-yj"4&F]Hm.Bm8&|S^i=W,]qN5Wj;vu-32ή*fW@KC8ŤpS90P]Sw{9θZ,~JlڠGC3Yb9|z<Ќiqēm6xXM]̗IM}QI5ffE=af2So),ŽF5r>mrd׃'y;EY#sؓYB -Mqk[U_QΨqOoY)V5VS:yC:ddg %FMx2,܍RqZiFuM>6ڪʎ-|ʛz8Nsl!JJyZuiZTiQ} cs8 n}oH$T;1yV陚faޖ gǃ I/yP-uyYXV);Mp՘9&] jV.[Y#3lj/{e.7OjNVPt!KiJR+ o+X1"_OAy>Yﶳ(\[8cLJJRP &VЬ۱n1xv1c\֮+yr%&`)*.HMƾ,OzoKRVLmkئ:lm;,[m+zDr KZ&&aM,/*^f.wtRbAir*r]f2\8qmץ%%yuXlOA=k<̻>W^X/I?EEN}9/[Zǫ{vs*6|ETrɸOdc5w:}pͽV$g"+Rl/%{MAkm"Ro"5`?A4fE-_" }_ mx?ECH uUWlqˡklqtw?I9PeGݫv7J I5X|jْRMQz+Jpiqyϫʱi bWn/-"dإ9=)7m̌ĺu/Nߍz<jfA~ E)>ʈ$gipȌ ӳa3z̓kuOҍpdrqO)Y{3{\uM>x6ČkJw*cNIn*,}mINl+ַylq':|hu{OkmMiki~KФ&mp[u,ۛg'[<ņA\^Y5*7Uti <MZ=^.R?Xޏ4ă_]Vǁ][_6Ԇ#ikuJ^*QI['Do%ļ]ȳb۽zJ1[ov2%ˁ_$+;Y**j̵$:z;&\YBL?byC'(?}"T+HI!1\k>T [5ct"qؽ:b5J/ݗsPݔz>˄}:zT}K~4[2ʟ]U< wN˴Ѳ%>bomPԪQ pHfq&k 2i.+1j".f]OGE].|8kk+⌒B"3 ո;ZbtIxj1sbm$U>9SeVBeousaFV3,0㮭)JHFDBN g7jas[$},ƭj dݜG]ȤL$u2"-3Nrѣˇ7ew~h$jtTyrlrn1VE -~'Wp߰9_ uRsJǤb}.0HxnHvtں^bK )ƜZGdfFF^ʶ.uw~׾6fӨJfyTY- "WRȌp||:z}QH _xs$Ξ).Z7+0_HЃ'y;EY#sؓYB ܰV\[Z*ClY1)rVYإ0cy DvmnIYİ F4ǟ^_b} lk{sUn<.D,k6Yf86ǰs8Lg~ٹܦqWYX8mHQW{'{\Qн#̪UfSєomY&-nM^%9!Od2S#YGD&կ[n$1+5SmwxApm͘]4Ӷ~LzWe+.֣'}{㫷\+m"4m ~5*%:-.9OZHoO_0"O0{$DDDDIK|н4W?_|?>ӧGL#jF)~= n2zKtNz, ]^&uN/;)aH=uЈmprUE^i.g4~ݑۦB9FUۂ,4T]bݠǧ GS~1;1<,۸'Í Qc;nuo J=w=HY5)<5F/WYn/KwWF1+{od`I.w,[IFR\kFˋ sgܕfT|S0gZI_`gc2B wg~/!5e_>}M95u%WWeqFS)4TDFJ##!I(3H [qRQm4S\~/ lK(q,kǛ_>3`͆r"L)~4fq Jд̌q|W1?sw?&˖F8_?у'y;EY#sؓYB [CmKZԔ!)#R)JK*Fŭ-ֳ$$jRdIJHg"nχ+Z2^,%̬EYMqyͼ6Ja45ģڹ۟Z,Yq)[j E=#qν%W")*x˚2N1 #܏N{Ql^>il_$i5Pnn[ UdWcUȎVKO[TuLR%la^='޻h[2]eVKWe6V/Kz\qxTR%xKi~N{xxxf۷ܹNys4 ˶.wf=>Nݮܛ.w&:p(:`m ٛE{kj3OY+:vk*2R8L-aAH%r ' =KCyStpK"ZE$c2iQ ;;5ǃ͛kh圤IZTt}2rb.IO\J#mgIdjwmkqi<quRjt9OÏי|T%kO@0.x/"&%ӡc2"L4ɯݓwڻoFDq۰]cWe~νLR' q.˫ȶϪ*ʄtj\V<]]]҂# 9եEsKktk^85#\ֻ]9>W+ms_oD7!_9^>nҔiѶj,J͕WdvQv$˯Z״]K쉹ct.T5}~۵nR|iqNk).B SpcOG˳gv-8UVK|\]S,kGv6 tk-]5niNw 3nȶ+ :jB=L -f#kD)xW‰N^!n2ϔ^zk|#|b{̥dҵnzI)[tkYUz:ŧzWZfl/C>eNOWc.Y{+ݑ OcD)<Ŧd]ǬCm4њet?26Q5 9yxIt#l܅!hq BCKW*I6g qGZӬ>eͭ$:ӈ48~J#22?Px0wy?PUߒ߸oE8TqFi5X$^Vdiyo+q/Ei{ 軦<DZτJ.g/]*)z\=s]}VGl\럮\ZLBauLBEaȪQ}MoL7#8`I}]:oģ2!O9Oe_X}QT)~=1ovw܂!p~XK83V:JWNs-繵GjFpS}Ol7cz%uۋUOoڧGڴ ۚ&̺|OܳU*]÷2pl%NzQ7$j RO9xlL7tg$(D6dpj=-lD^o*ɖDw'w7TŶk HҦNqZQ-^/bʦ&Au69?m$oIV]^D- ]Kv8&iz/}Ei S[-ǜVV~Sq_\/1|FlUeg/޹'Kuœa~3*vsN {"'2߳D.IO;Pِ^ +%iKWUҡK#}< x+AiDdeԼH˩]SӯOנQ/xjq3.k1y쓳_ԙӱ}d)Mldِ&$Aet/2qc".hKPRs\ޞGi/rV|2|- {>?V sԩ&w>+*BR,W{[ִGS/=aƫI/Ǡ O)@ǧ>^ 5@O_.x>'_Iw;P7cl|Pkll6#3o,7QE9S^i>cÎ~C25D;XxYZ]Xݻ%K[H9^([m. KM&;{t| NljFcYSXeQIG6Zlxkf<<<|e)M_m?ޒOZ?)KFmkw,-}?fmqoL˾s_"}Y{qb}n/`(*n|púJ NIes)rI92:{YKRk'qnVp9-,he7gL//6>螆} $ԓmxCu8KIY*)wN+ɣ\i>D/ݸ&IbFG?P~nM>g9֤y$keI]J^E'8FDbfFDIZ^_i>/$tՈ}?kWSZŹV)\ٮOd"og,^1]:Υ$/"A<,/BH[-z^"&x&%2&{%e0H?"|FEFD"|7\KӴq9Gdى[ʳqIۯaX½5b_6!c3}{A(4Rba4I)+RMR̍J3;Xg]gWsf>f;1T$0^ꤺznΕdYlzn1]{/C-0p>[mPߺO Άt""3Zt.mE/|ykmiLh:iz}AێݰθW)Ih\ux6/؊;xP{ɿ(Qjɩ%ͻ vÜV6&I]ٻ3v#Jd&/<4M#UN 3j [*E>=Zg'a>NqT|x$ςApV^έ lA͐Qqjo+b*K\@6n՜Hϭvv848ikmYi:- B؁TGK܆ZC5Iq{LVmYȹ 4qi rqǶҌmuU:WK~]%_4F܃α7r L˙Jʛ.tr6®D%c(4 a/8@Sy^%ݥl\DF+4Y&d_^iuXaLfڈ,HZдC&ewKbꎶo; qjMQK;N =־v{s|SeaSXxOޱT5(|8%Lh\||͙uP<KEb%0'G2?AuM>Ρg^d\ST(=_Nwۼ]5%i%h^ù=4! M7&6 )8mdu-ϓS!dE9)2#K-&]HP-o}\:xslhߤm#~Y#ԃ'y;EY#sؓYB -+6lw#ӻ.7 2luLmCwϡ^)WN5@_ OR.po^e%[JsVye^}% \~!Ϥ|Rܼĵ>'h◴ݻ1dycVQ,fcD]N4V,^OR#r3 Z<'s#^~n?C}2^r՛~qqx5JjRi/'UYFsyїզ[J%j!mܮo2dU=3*4uKR'$!&'3] vL55܀^ٸ.~ǻ-HyJrhkOɃG:û>˰?lYӵ<}B=.B$E0z޿qiͭmʫvvͰ RekSŅP332Az (a'? `FnܟՇACH|XݹR_Zm B1g7^pȉ$өOr !0_]HWM[m>H3#I|i_pj\.NmrR$nR˅&ӍS"N1ufۣ_B<@'aPs+J1㍣Xy1mXzG>r8BulIuѮ?_\Nn/DgZ֍ ֵK\}jۥ=h)qmA;?Khﷸ]-9S]F)O>/N %HRcsNB)[!"X SB2#>#QS}>6I]LȈ˩LGK}\:xslhߤm#~Y#Ճ'y;EY#sؓYB p#1~@v6$cm!1ݗ-iyvb5 ˜MȒbBRfmϯ8{LKda5%Uj/kqfN8֊pmwM:5TG?-{q.91`1]5~ǣ'XfLFCzL7M(|ԟHpMxߏ/U&w%~ I.3! [l]{Xoy|VӝZNnm/>P0.6ko#t+wJ.WJqi֑}ξ\Ӱ Xӯ=}Nxu#Ou :5u/GRi2~>wOG_W9ΛEʻluFz_eOQF\I$[Rcfgf6\y_5w%=z̥B ^ 1rvrHJWLg#YɴV 'H", &Ȉ7r]=YH;B]=s^ZKjl[Gք!eS#o7ĮE/rkjg-]Č[rr~>FrFQ90em31Bw[m)Z+9MMK'-"%k7!wZ\y{:W`{,ʶD)h3LX4J} 6=Y1$CD>KBIٕ隆uG6һr\a̹spw0nPn3jqOtګFӴ/uN?6>2LSV#8Ea.!]0$e*ˎB JZԫN!O;*SH!!n3RJQS2ۓre6Cle!imyHGBJRDDDEЈ~`8>q=ޣk޽{׻{Bw3yz<zu:Ӏ9?g};i>._d~ĝ^fߴ4xzǧgڠ5W\U{ 5^ՙa9]Jȗ]'""RPn6ۄwõL ׭ݹg|.Nܧ;y%]ɵT7?h e'*4vaJ(rMJ*,[뻗9q=7 xGg;kF[krKjGo*59]?[&HrJu,D=ͷ@m6.ڙs^>g MS 4e|֚JARD2,Ll [xXj*1^ */u̽ek윝tR1\I.z@}qN?ڣ ǰ#&*bƾn9%C < S2_PS'5;%ѕ-/jݿ`xүfvEKg!k-Ï7KR~]ImIzQawu.k|8njiƊ%)>9C?4v]OV===Q1Coo1T:i,SW}WRB!9󏯖C=eql>SO2J48ӭIRTFJIR?hiKN.bmm8ۈK[j%k/2V'R2nj\W'p-*.ȣɴ|Mѹ%$ 'k0q~*S$cچ_ȖZdh_jiݹN*1Sq}p?rNը4M & :N|+MkjHJ o}c%?8ʹU)0lܤ1..?ȞՅ[FpݶTw$jtPmt UFڎUvK%Ĺ*Mii_ORIy%)f37/MZ}vwόMR~XEvFI%CUjrB6lZTj (ƩVNsNTEWؒ\Oxo%uwj3olUU-ǥƨ$͊k6HcV<\ AuIa (M:*)Wlo ޣ i]v q_q>|]d|)_I +Tfc102 |1yqΟL23\C+9>n3.舲K1eKwg=?Sӷ%[+~S~dx{B(Ȕ]mhZD,&ғuiwo"k\vZ+$ڬW(̫ڋgpnpƊ|Zc (lgTuX FXǵ6.\!*z.{0˼*zsߜ-5aA5ŰqkJq82:76Ԅgfpױ }MRO7Sq]7 * $x/%d'IhBkbk;\m`Y|)N.Vڛ=4eCB;^lEpr֕_VI߄N?~~t;BpA'N)v1ms6]L/-:4Vpa]98ߑN˞so'wމ2cc\rVMgO=UL8;!%3KSniSUބiYqsrq7 p_mAje,V-v9T9M&I#3`ћULw,nPlںpMG EE(KЉm s,eڀӼs7nP ͫm_-Q״*'TN=ϡZ{#qr&>OpӛtȷT|z#9"EѮg\7OrR{\זϼq(CirfBfB|s1c$%T4LIԸĒ^)cee0 [Q|Iy7=L*AdⲦkl,TRȕYzr]m"KD] mOuծmJ{xUKF_lI=RYtmdV/a׾b\u m<.XsIk{uY\'cqEJ{涼NnIt.Qj?ԣ5)GffgmR"/^P97y_IxPi}>Ky{@i~_@pa]Q_eoqg[KKM]>stq:ZxmoH}PݫV94Rm$>/߷jWFUmI/tv485IdՔ5˺ȲDFWˠ'=Orhz;7fEˮ1~-mgK71vlL٢$A)7yœdE5/H0̌(͈39 ?w9a`v1@Ͼ 쨅y]Ljneӡ:}irbee+myg2^.Em4*G܌نt_#Zr.mcFM\NGxnq;N2弣qsvY78JUO/:]h\眑!uV@.:yjZ$VMy^NK/9 %^9C4#Jl|O+t/&]~\ۉ丕imxvs7Ӱ蛰!qOm#7?3T˫*|i;viҩK=8Yݫv+ёq&1Z'5N}Zarf3km*upaώ<͵vkzI6Բ։YmIK햴)EbC%[~9KfKfDeZQxAi?ƜתWo,f*R:>^GFch:5f7#s96~2ؚ,)NEd:<ijFqm!|(on8POꙊXŹqzc(?rIw4˺v}?5JI{B:mk=2ohXr&*2',HjBߙ&^b#2|^Ԗ-=Eɰ˖5{Y|}RE BNm/'FԮq坩S^*4oakUC |S_zjtRRky/[#;foVIϴB71 >N8do{ Iȭ6GT[(5O^)xtF|~<|Hz'̺ wĺt/|;_Kx{g,zқAae%Ui q06\\yX mkR &R\4_nl8]iUI*Y cˍCn~Fo NqvHegdVRupzOlm).Z3Sי֛֡[/6]]嘦C p.(*M{2MZT^d-&-!IQ~V%;sqKiF{&.!i8)5FL[7ZeTμô|C.'5aI:]utj/褟TJ"Dw'BgqJ|=ג%_Pˆ͌(XU b:vGGQ.bM[VH.>PmFZST`~.E.(/(V5O&D _g:ʻ8yL.Ĩ&͜U=e]&2?ƫژE^F!i3շ:ROK/jzy߻G&^Vg_k BV})^]S~ҽ˸+6|riUL2aJKUΔR 6PY&XӜgٜ_sc_; {b.VF1e+#7WFc˙pd.g-+˃v(׻V21;/S Oٳ49Q|;\y9TDv(5;w,+O V댦1EFy kaVgf']^Oc4#8 =J{L]ƍ&69u.PsRrӝj6JW:UdGIF^53{OGܹ8R%Ö~]cf:ȪrTgJך5%)$(U฾"$V/+޺ɦZ}On;$'_.L ]V+ȌO"[t}=PLƸӧ J6eieӪ\i^t(~]z _W$(Oiޟj߉%yLїm2zuIu#^v{q(l7fǎ'91wq⋮Tݛ#ڶJtgmHٚIp-$束玽\W+(νxp_F;i5f؏SrMR(Q.gYEQ/W,*Wi7/\^3%4w\ku~Us#2mGyn&Ts^~Ff_<rOɲ~l>dу'y;EY#sؓYB )NAYqpؑ?mCkl-iciIa#A(: u_(N2]$ ?CeD֕Ǟی8'J*-<䦬s]]zeviNBm'igz>xSuëlFï7╩'mJQ%^d>_KB]^omm]bi{6Y֌$NN)mj%965gJXU2R^hܶ$/m%/ARct^4}h]s u}{ٓ>VD[Zůr|es'hswlmU֩k(\KdJUEM-?y\\5?Iļʢrqvj)2|S!Ŷ}+G$Pt.ol( u(7:`e[b\2Oûœ.[9u [Iϙ:W N9_\{\PbjRfFEW.8Im(Td0WOAu[PPdԯ="'i$H*鯫 mgqL\Ai%YzV.J ѧ:>+Q7cߵf7:jѧ:5kh1\%įXf-!9X"ʼncPbbB+SkI\_kz}@_W}_%NO2^Kȼ||?^ӯ^==}]> &qݿݘ3{wIz)/=ocҳbF4u'LRx׺N:?&r9O5㩟Sg)6k)G*I:JL{o/ja:?jZFhi{#w+^J|#`ؙ/0wqׯSTu*/6g{ʵ_¹7dYnۖcњsxG, EӧDվFOܤQ!qL ~D.M% Jb9(KGKlI5$E閞IzXS7VJzKף >/6 /r.Ru#ƌA6/+xioh]vbE?|z<8 u%yXO \6j{H_BfLBX Ju64*4&dx?W'/ha5~dH s&Uc,٪ޟwŎڞqNMͧ]yL*:O6qRVЕIRHvwNi˾bnKF^?:si NIIJ~ˆN/e"ؽDg&ϖnxF%q3N<'=knm1\c$<`'MB7;pي \0nO7/tFUk=^Y ?3y}*&-jdH/#%0UE3t-Fޥ8>+Q2]}vg,-ŦsbG|hIGFjT.*oÐ뒺.ݚ݃s''1K+9VͣZEtOyOGy,Mcysӂ4v߀R.\*؏m< DQco?>|݅).Gw+^:ӣ4%zWs\QnJzvtiJJ'xҫn.2~~Ǭk~k2h:mlw0Ի ,T;{Y^%ثf\s6^OK'^b9k~O~M-􍿕dq?/$҃'y;EY#sؓYB Nw.krMWlflk,DgJndlqti~#1nhvrc/g:5H۟[%?Qr֕IUdc#;tܼ^ṱɚ[avK.)|ڒmع} h%I[ UT_mV&L{_VaލUQkUW8Efg5'I*hT<q)X(8 "TOSju,Z}Ƥ$Z/?/D!IJKДCꒌyWb"LdI.\qV~:}TRf<=d; 'n?<~C27xu5ND]MG@FDDFff}LDtڼD+ε?6X d 4t]GNBdt#*IRJ>*. WK}WIdii6]Xkk-^%rK9%5/ncMT (T/OCwz6:H/KSn~Z H髴ZhԼSgNG&iT^Fغ7l$4ZʊN?%}UF/6eqq5.m> UUW_o~}~|o^ROLǩd*z㴓_|ڕA<ym=h*.]L8N3\YP8]҄ͪmIqԆ^iSjZ5>|]^i9LON#8>$^Z}qCJRpӇ@ b9k~O~M-􍿕dq?/$Ӄ'y;EY#sؓYB ͔c cĊ]IVTI8r$ְ2z;G p:mSjQ5olfӪ+mRk܇7q3 oN0j&>Yyjwʆ2]o'3/e=i> 3*f=W6 1*bmLh2u(2sZ"dp> C kBJ[I$tNg_uH$oOo|O+(De5!jZWdrkLԧt-JYJ333Gïs?P*"/_*I_O_09wNӯxT8E)'m+[Q[\iZ}R3WSi>bE.}[g :!Kyk7ZljSD%$@F̑\ۃş"q3OyPx u},Ϲ;W"e]_mQ.۞V˴W7έn\$QÎ8IBS]l5%M̾3_ 5n=pw_&ӚcEœ$؇#ߑR c3iyUWeLDں328 ɎOȺwlL/??˹g^Х0\, IЪғ?IOX!EԌ]KD}:<Ȩ[Jk WP?.UTݦRCLXÉJ-FӱV\-#S~ UvL35l{Ҍϒ.N1t]Qqhp[NS*ҟ_*ǒԉk~KIZHd@Q^ٛ;ǵVvI? !Դbzm&7^_n-(#QRó<ݸIlLtUx.m%Ŵ{ƲIwk uWȶɳlƩ`EeO:kWi'I5,% R8¾ɫܝ,nRʢ7Ӻ&5J"#o2+>SJH&FbjЇXu gwobʚqެAѯt{?;^k'5qc)?֓~TN3{v#yu_|]gbQ; vb.8/qkf%lOLDrQí;ɹMT@ʳxL{~"5Dsm1&E-f}H O{\C4%..QM6T;Q7pGru%MRPiʛuOr^'|ܜ[U# V+j\dz3Y)f^ݷHdB:~kI$% Wdr "/\ұ%f/rj,;ejS3hl ;[h{c8{l}n=,B'`GS+0@”-!F 5L;y3SqV-~ik> OLiڄ.tkw49G]3*WjVo1֏hҔḽ%s>"O%z;˨JdTIЫk.\h0b0;}1iR֤%3U}JɫpUri%b*qkJ5Cr亯+QFh}T~ 5(B)8.7Q3ys 7N8Y¹e^f oR\j$Ԇ@x5-GPkNEص+nZ7n:^7^\]$*v慺4>YU4F9Hroy4m I?eN/g(%-J)hYlS:qN}]"k\\WZ[?4 3U'RVZ;cje9r{R1\"Y-S#Sq([[qxO8}sKֱu]eywa ۣ=mn\4V'YKlO)P+a9&%l8PSm[K}\:xslhߤm#~Y#ԃ'y;EY#sؓYB ݖ]}ii8i)&j'H>puWʓ &A bˇ.+iQdi[n6hZJJe(IN S\k~iQcΏ"K-bˉ)ߍ*3OGˤiZ4 ###2221|;ARTRMٚ9UD(~δm7 e/.`5rI#zK]q]T`g/ܕ"Prm7&HUcg̈́RIh%긯#ycg+3!wvlJ{?ǩ\uqqoF#-${Nr~w y(_{d^.;pV=Qۻ!,1ɕĔHqOiJ%omMӕ6FUIv&GlVMǠRm+SrjODF !X~>nԥ.*}2-S/(aJoRv,܆4I-zHZxe}w,on-J% JcvHkS4"~wWI{0UEZW%tFJ[ ŎHIInGTj1Aӧ_mZWi??-Ȼx]>96?oq,nZvq^XZ(~zb;sb'5K q\! ֱJۺ\ۯSS^?nNYt[,J.} B'_XYh{;6oPc#W)hs1hۋ7pڤ6ߒJy :Jq%5Ŭl]ƃ/rzy_28zrI)Rn'N`Y)-*7I#^:׷ r^kpY~BhE헬K6WqOcl*V:U}[kji1Tq>鏑fon9I~u+Dmzus/<8g8Ӄp\{%. 9J疕k~Jw?O;}evXkiồ0YTj}}qi>rBˤ)QYv|_ʳ1W=#10jvCƒM"#3#1r0s%[V*ⳍ \S[}TuMJ>mP^VȾGl>]=W5'qD덕3n/{\bq5dKTdm}2f=ܺ>බ5w%\ JݛQ)UV5}mʜ[~6oI+S|')CM|9MTvrp7snkN4Mq^MHdM? V`i-ڗ4fu6|I,Jc>T͒乳pߗ2dKuV-Rffff2F*˓mշŶ[~&hD_,c ;0ÆqËbr/3!ޮhn>mz֟?J-#$N}̍[ͅ[7 $lN䔙]kN=kuHٲZC~^^] 9/-fAq9^z=='7"6F"F _\R1p/G~csNO^*3ԋ?wWrm@Վ0|KʢO?%q e/PlI/1LtuV k#ZVqd,;׏o#}϶_l)5cZ8_IJ9vSqt˵ӋOZ~S|ѹNa,]eͥVױ]u#{XD.S㲔CdHTLֿ7mQezdbV{^9n)CrBVϊV(ҤZ{=b1ǒ$}3R21r0' %ښ pkz[`y0Wck431YXDϫ+JТ?_Cdd:H(_xs$Ξ).Z7+0_HՃ'y;EY#sؓYB s;#/: JR"jmcf"#-63;^k-rm'Ib,BSc$j,'Nߔԝ4qM2R>$Hk[Էn(Vc*p8J1~ո7EXSwyc{=Şd,yZgC 2X gg9Lڶ]j㦓6MQqFNFhˌm Y~rL2m&YX<Ɵ͊u̔F2?;Rc:GOa{Iԯ5/%i%2ǝr_E^@[m0mÀc9)#۰Ut&r$q*IQ!-fŞ7l~^VR3R22ǨUtb7Sq`&cɵ4ii4]SQkjՕYQU^-b\}+/[mit.Fr*nI"zˇ|ܒk]=H2PUu{)Hj]-[Fm.dČ{Gn8dx\.uEC7l}7XצkRk٭= J25D*?^| ޚ^lI|\Zq=VхMc$ޖt4ϐ߻TdFah#2E3QƋh` bǃ_$8b% - (BHANr)IշŶ[oV6b$GI2lS'ϱ*d;KK9vsR_poH}ŸԵ1lOԺ"'ӡ)x>۷eǒ)dcwkީ!4N_AvtjmJ"ݬ]VtNXԩZxlRR1K?Cq QPϯȇǐBcya?xS_oʝ/^>Aiɠ7#!JMOScȖ4慪IL) 1'SLz̽c|d339<+ܷ_G:yt<(X q)͹ٟ~* p8Hef]#j vK? !u,Eـl{O|58ͺM/v$YT.R? ?fT&^Kq /"OkOuh WXzgε2\ƿjo*lL7tgwn:&Qquuj* $CUo Ei^Ue̍Ͷ%:JF}" c-6{%u![hVy,}6fV̎r:<*skkL1gϜW ^Zxd}=MSA7MS\n~I.t.#i둹lqm'[S|x,ncELFo]^ҐdvBb%' 墶_7 {6v cfIəSidG5*V܈SbZeŶ<=G7Wc(?44}034`۹\Z⚪k'ƟΪw~89Zm<VIG}%dɎ.~;[/ۨR *9+^"n܂[6v2*_6νm?:ҤJ2Ti|>]ffN[M?'DzZZ#w--HI"d8츟7 mv[Ǭ3|5\z<Y,+e 4 ֖D~R^(cba\KPjc^5_(cm )]Yz7c8K+Ԋ>b^VZ ꕺ;N.S\梹89tywCf;7jw#Iw Hee||iڈk#>Fmm/l]O+[I'X͒&lԷ^un8R1"D$$r1ܹvn9JNVߋof`kkªجAf48P-h"Jm$,|eӱVäֽԸk] VGzSV";[kffDMK1xu,G~/if۷i()(Ϳy&蓮7뭥'8pW;rcNi45?z_.8g{nfԶ+ݽ98ߓk*')1_Y*R9O6v!ٲ G(ʌ8Hdgwd}R( ԇ)I?{';sMJ-U4Ell㓍' uMw~Mpi4itmpǀiϨl1 똵ȨmX8ӫl#JдR2()+JTR_qRvolHmˌ[Ʋ+$=>f c]KWN6Ff}z+;["n6Ϣ3W()ubƗfFJ_bj?Qmvl-m0ɜn.)--Fầu[ GE˓lsi7'^3H|Lu۩^nIPKYmR@q#wq mԍWy$5ʓ|*J.Jթ)s֤iU }_jɱ\$]MeTgX/DS.!ͩ_|1?)z:O~F i_PeA+Y'͑bk_Rxyl}M$E1elǍ.֕}CY@y8ڜx9/n4 /en>Xf;R?6}_VķzcQ(/[m!2#Vm%=[vr^B23)z׫bPy}~di]́/ $~_U?l~hB<]:Zȼ:x$拊{|yFjSޮ)GjRw4xH^m|Ȕ7Þb+ Ln!Z:HCo̡] kXա("t.%05ʼnk0-*GxnQuؚ^EѾý $)_DZ/&$Gc3/~f%ڗ%(-3e&GaoLSFKV$6W2FiqGRRIw ;l~zmln\C6GeV_rTnnV쓊Ï:Y[Kfy֖ %omFRrjQNOQU=CTnj7zPTNoۓU|{[|{}GP}+|Ѻ8U[?1j|>3o2YM1%-{h~D 4;G@`ÊX^Q8kr,J&h;ŻZ6~.[rqV2M5⚣^*ؿs2lNܔ]S8<˱S"ͦ=׵H͋{.V@|d~Gum ǭwE/$4&<Nnm Od4խeZOĔّMczVKGI~TgVQF#$oMEǙ&^#2یnA9iiiAGj0$&iHlğdDFBxzB :ux%:^==GľB?GO.?;|:tD>u[Ŵv+eFwf[vr 9)Gm"6];MьO2FJfv~Yɒգ U蓉K"BB\7T4ʙm?nPP}]vK^$G* ?/`J瑲E^ -et3/OPmE>OWr]~)~H!&U=TKu2oluz }Q/K^b*-r1uXVt=ϚT|TaF]Փ%2U Gr`Vn!WYFriRFLY|2Tumn-ާEI2YFMSTd{Buۚ~;rHܝ}hq|i5(ņvWqk^NDb#1‚O*6=Ṅ#n .RMPȋbB5T^^iI#">׸ _mpfjK,&3E)$%м5ӫouzmUߪOэ[zZte6:m\^yy|Qs=Uޕ9-9Wac!lm=%/ BGT4>+٭DJ2qE"1"Ix~5Rz?=?)9`o?x+*E"!91\o>b_<rOɲ~l>dЃ'y;EY#sؓYB )RII"JHj3DD^!JBI3J褩'd~#6$Ǵ-.INhAt&6]&M",˧R݇̒D쏤{i 7 PtrBMJѭ_ɽHѫ|9js%TIsZqx%Y&>"*noZ}ՎBr5SMm̝\=‹4ߥQz*|0zXkLU|xws}/Қq"ײC썃3Z vO׸++P?{>kK KdA7 sf,;\&gp/Jͮ}[Jti<*wDAsD#oDn/wE$^7K8_'Z m\H522>FF^2dX 1y󫛲u˘y ԐUե&KE3t!%\W#GUc7~$ŲZr|Fb#"WלkJ,MHJCyQTr=lKI2jGU$OqmNdQWֺ!dA3F՞{C_nEzx/^}ӯzz>ʤJ>e>R8 /֗9w'EU?-1$ $!N&⒖#Rx%$fgDf<{z Z_2>ARKogVdoRųgf^IIR+!s.{fWM{ѽݑk'sg^:i?_~ZzO'LLO: Y\şeXgXм{ <:\t/%5eJSUQ1ztz1q'ZAC.e;A}f݋o! tg0&-t挧mJ-IV-ӂlg3m xgbidwcaniW5rͺK/wJ#IRL7"7VYsyI1K:j7Fd]MP:~5;/wZ9p~/UPƵ /O2}}e$6ڸo-{̯qگ\t풍{:yrSǒ2JY^t13.% W1?sw?&˖F8_?у'y;EY#sؓYB _$mNqWFs[Wa=2cJQm>Ognr [c/Yşr9Ec>oM*>?Z y,Q?xtX:}4 ~Ot^&)s|ZSkjN5dt7&+Jlfz.NJSUN]c. ?*EO)Bɱ+:ٲ뱮jڱ+*R#4Mg\ 훜qZ󣎙/#'@9Nt΃O)BvCBCMrP\6yuvd5<'Gtɜ)qd?PqLNj)ō"RylQw nw.m ~ 2!97zki&Ҋà=ce>:}n>H7LVuKki[zVѺ1+Y\\tYΩӝ~LWH+vjk.9DbF\Fl˩72a[{>rqY}23rXo}OM}Wm청P #rR`(.O%7RE"D/O_m|Ȗ!8j֯cVL[Hb@3{ [SrmXfpkܨld9J?,[/oGVoe9^ÞMh>2f{udm-Ǵ,%o68ڊ\Z$~k'(]'n3t1vNuor6dch]Q4t;a+z[u(n!r9p[spk2_##:ڌ5*tz$خ8ĆYqm*97PƆf rc( ~O|>۷va%Tiש1=ǣkf汻lc1,qtq,,̨r[mlnH*L+" |)\xTLwO[9Xi0ht;o,r af̓3PW5LMC &T֦MQ}ުRЫ9oY'6$r7>S.7k}ks 䌂Sd2WJ 9ߏ5eYJ7)%>Uy,οm,]I$ Rz6oL_ ~->ҭNy\_bt'Jבw(_y%iWqns6 ^9*^q3Rln%22eh.1K["SPUA"Um4ZWAu/]| n,' ]$]>)tы֮X+7W,djiѯyF%,#[QdUT,mb"}mWKyIrS9p\ 3ÎCN.[fE9Ae9DE}~rWO>߬`SҲ4nq^Oң/PZVKڹ/L+I~ |bhNqO<{6ϰhH61|FRiJFdd]#C}~\$VIBlBfK ##2~cM%Fضxq];?6fVtuU}>>Y,b!Pn#;dU@IYRu%F]D}H.'R>:~I)v>fgYҮiz&Š%J\qi(\o\WbNלkdEqܛril^>vרW,e=y]q zL&)4ZCq17\L pw}AݝCnMyGeNnK>A)%$K6m:dpfN  ՚ND%v6DczêoʸQJa$5iT_ gxl"fMWtZ\ld$~,4#ud҃'y;EY#sؓYB n8wt 0q_2t$ʛRtI%_c{⵵fKߒ_eFʅ?;c77B21;u_j.^^U&JY{SV_PxbA xr%l'[{nk&o^:lxr+67~잮WG!KzBXQy^Y5[2bȿX͏-U(8j_|gwo]%;7.5%vq *.YFө{7n G^]E;JUMXhmՋZB艕&8t.Gk5b\e&etMgLqqkN./[ Zĵusj!Jwٯk-GNe_jWJ>\{eWr*ƽUIsf{rQkQΫ=-:M*$rq|Cvrͧc&yvkFǑjrwD6|Ժ{٢[ u~^>Op6 E캟 I@,>3y,Wxc`Ki83O$eqJEUsbm*{.ùv]ZI9\Nfb,+5\C2L8x{R1)iJ>#?es34;22;3"-|n Cvvw_Nyq!+ mkNʫmYUEӓoSmJ1j#ɍ:u+T/7|Om|ȖȩlvF@8V};^o/ՕK}:Ee.dմm Z%)73$6JWO:gн'ЏZ)QT*MD4u?AxJl i?^5_P)3]Xl;q\b0.G$Qkr21yefXn')qj[ji_P> YnڧĻ曰 wwvfͣqOCgtEf9KP%*G )FgDeR~@wq[WI-5 Z Om2z2ĥͪ*!BaFff3S3u36RVޗnvTRi\\[ҧKW+a]ne.JƵM+{\|D=sq ??ҧ~dto!t,W"V7Im>Lĥj]y~ӪW!xX]LO_Hn\zll)k; yQR/YuVDcn*pjQ<4Βƽ{O.$%q.G臾es<1`q;Vni7)FUq(yT~|Oʽ[=,F;=#%E7#HxB%>Y\X}RY #4*J+JТ$>)Y^I- IhRzIQyTecSq˸˩+T4TƮj"}͛TǗk :Zˡ"SG#=֮]fu[R#^4Z//%uq|'WRk~w9ZMv[sq1\și" ̭es$XĪңi4:#:`7b{wjȞ+j %1/n92jfgjr/)=|=jNsb sΗ5vW j/k(ڭ>ˎ=W7QHu1 FXԩ6蔻k%~uT~*zF8e?FWCzSr_;i/3RDE qwz׵:bG%)FͩȽIf;}~NlIF;`F+?2+ə'%쇚aoyqǼm3VᲓWnm#D^6D~E)=kdJ ">b:XGP{N{[I%C7Jeh~_1ȭ W<~Q9>gqګM/c0qd6өϩyud9%5^c_v-[Ԣ湩 z^[F":惓ˏ%/BT״BYb9gᥲIo_xs$Ξ).Z7+0_HӃ'y;EY#sؓYB Vϓھᝯ.%:mN)m8Q'j*%ܮB#5w7MrJ+NV謕L/AGT(;ې~ۏ8]7%4Y#qfr7 ֣I#3":SIV`u>(>ݷqcԏt%ux}SRtI fܗ,]hLԻ6rTg /*.} u!hF#_LcsHGC- Rj#-\ !t ?LxJyYrL.6x6&e#R%)IBU[>/^&7ʋ& G~$ȏTY-.<#}tHZFDFFFF]G p$%F4Sf>̖YGo0.!_e͙IRL$̌9>O/ִ\g&ǡXו`'M~CZU.y~nYs됱®Nr܉/W R ާ]fpHSBLǫ䅶8졈Lx%[?,v"$J^!5rkUj5J+Ç"e&;>%sg r||=ftt*̎*t6c)vz#Գ%Oi4gqꛯӝG8&_ܰwO$$2G:#.R)U/N1=뙪e>))۱!VUuקaMG⒥,vԪ2kc>wu{qP^ve=EVJ#9lROGa'( $dJyj"7tV:Oknpqii厒gsUISncMJ󼉴3H/(Wp|cPz+/lDC݋dVNBs_DoHnwhIx'˹fqZ'T8Bx~=n<{-pۍ{\s^ϕWdI~7m셋adE =adi̵8%\+sTjmdDpTkGaEw?12E}1'}IWi#3IqM=wHq(SsFn'ïq0D$ΓKt|Om}2#Fwƅu}O{?GE=">IITw}=$\'KO_mԡn&O<,b7a_:5:njK*e]IF]Hy<{iw_jD%)g}n$rE<4)}=m4V&ͱ}bnIM/*K]Ƙkۛ'+J*:'/.ھIIqP BG%3J~ppsyŴ6٬mtwD|#44RU1Io1/a2CkgiWO;;mխjrzWYG̋fpxǧA!QB?'L_WL2//7N |RFomDRcwtr2 $3#"^"R&ׯgpi/sRxZu۶Uy݊8F~%WD,y>nh.?XÁ`шf$ěO]MTq}:}DÚz $BZ)ڟuNI9_OSM}xD҅] xZKNsz4TDd>gj}+? 4z:.=leԆ_&l:bq1 57 4xQW5?^S'̝QRGWC.E`oBěqlsѥ]R=$^_κa^T!9SƑli6ccqftzwl/@+Vq=iիlťZ.oh?7WK~qi[ɳ?k3S *|q 'n<-KIƋ:oaf;{S/C? !_*֖Ke ݫJ{\d\]{nVV"w&qx=/ȍ[s^Â5-.N3&;:Pˇ$ވЗT2SzunmsʃEda[vvү L4EDKh[6~OFu3Vvဥ^s\)ʢM׿˴ [HqngE]IF )&5xժpRKp_;ˎcm]Cp =w #- gH3`V*А*X9*h"nNG>rn;I5j0fgRu| i]>$JO^1kS6kNn*߬ͺ/<~4qkwrQ^&1*C#^l~窕jiWJϔ=pt } ^SA~z<:ףh }&G_?W] t-h~q\.nnKRM=TǰIR~q)i2Q{HΖcrRjUjp-jzFF (ܷ(.ȧT[|J]eDh>C=&iůKB2O.UDg,#,GG'o}Gk^\qǭi. =ОgQ1p,"8_4kB ʄr TijvnIAӣ_ Oo[QW}M1VVj:2fAT:дOA%3>=x36 -D)ġ/d B[?|o!|gмbޭ`~bUv.#4*?`/Gp›tj.BT_{rOLe2Ρa;*CX"Cq}G/u[Q6%`>JOAtIc]Pyz@4 bݙXLP'?Iٶsdi2ri4xwE%SVܢ]~ԗa\S(^IUChͺfYzhDF<|qxvsb+3RL"ԥu%Q{SWmFOU4.Ѳ}඿hQ28yeZj#cVqTMuuC*AȺ̸rNrItBuUN\ڲ#]VD6DP h{֫/xFꯑqtU^Ƕ*N5fҫ˳$mD/ܻqA@CK4w$P|?v(i7 .n _9#C005 /'tNrѿH_6GkGՃ'y;EY#sؓYB ":fr;a2'`|bT=tZ[QVL{ԞY.:+vb5:i&t׫d[_vzi4zds&\ #uk]v]+4%`J'S'O"dr\SeK⥭jR>ffbAI%g)NNsumտY"ѣ8Dŋ؍3 LGDIB$ """""??@ -6ڶm7['Tj=5ӧ#H`#kWrwY÷ڴܽr_|ٞ;Z=>7n4RRњ vW=j㝵WJ7oge"9)D?*294ETEDEl//W@~?_zESB.?}F~t_A#%rKX/4Vf|Y';O!>B[Xu*R9X*oL;n$Z"ȕhF {/xrtuR&Ӕ~IwLl[l7IFKլy܋!׈G \Y9̞Z82%g{L>6Db#kNuYo;#5*l3%\f͚5eRz_-\K)s@*~Nt`^glk`bƾ<jV?> W.K(ZŹ~c(JI*:5pgo2k?eFqeb} ?ouf+uV9?ܽd-,vV9ӽErƥC}Qq-aĭ~dR]ucVU ܫFŇхBvBʏ&;4fi(дt5CPA˕GcqVqMNjtfwrw QIGHNIպK|{a^F|&#͏9& 6| |sՏ\Q31]S[o]2>?Xz=F#O0Te󏧧jil+miq+. BW:%RTgZ}c͸ͨҦI(dfF<;7)4]C<K[!Ϯ/'XQY %O=ⳭVe/Xs{ hNv2FT.3N$4-s}Im=Ȏ)cfOé#N[WEHiSҟIڱ-L٩ &6S3)Uok}iu;RSr?kT០c[ _7.g9%Jz}^asnrr~5;j1GMWMi,;PpXVPPb->ڥ%KMDi#!Je_6ᶾkB/215M}w%d4mԕ:ZT <̾8z:_N4򚋯xS/ĺzrJJoij$%I)Gu1Hԯ~5{,Kb+mKq Az\qu% ꙙ!IO"䨾1dn"9qΧɧyLiq1U1)5-_.Qwr=xӌqC0jetiƖ]Ӎ[[k/&] Q1-hH#cw?Wyzn#K;_d:Mw([6~A/'|Gw"mJ \k]r&e!&v]gol8Eua(Iأz }+6T^dWgg~,bgrNܭǑ)KvRʝNz9L6SGƮٺ ͺHjO5 2kpxwx{ɼӇ<|73K!I?,_%VfXUnw5/ͬ$پԈIZgXoiZܾzc$(4mNl[oqn-r*K[iIqrG1ϹͰlon6XnK\K"A Ψ##nƆ<H"3j.[:[٤)0>Nq^$R–(DVq鑺jp"ݯ^4/7V4˿9*JasZm KţJH44R#)9RG*ߔ#8ބYq{5xJ2Rw>61s]U,N3ahMƀȌd b9k~O~M-􍿕dq?/$փ'y;EY#sؓYB )υ_ۛ?jdbNYm f+X) 勨ZI4<<(J^rP~\%'qi*&͝C3/"qۄ9Ҋܔ*JtDT*keo;|̲cdW+ 7E#T&:'L".LGn"O-y\uuvɨP) OߚvMNgSȃ1.pLHZ6kXqn~vI{imJr0~|zNh8wVxO<[\K&p&ri lOצ&_K%%̓!B|2. h.ÿWLxfWiXeQq,*) 3c^g!R=^+5I-en&m{.$]V5qRIV2Woy$½vיE5ܒ]^+͏<kNoezj㚙{;?.ꚺ"Ts[bJ5yG6r>G)<:|c%eus*%PXK'}da@~t\?L-^vV쯂ǰl퍬tVGG-uRć7p>E/< ][%Acx#(5zM zt^qvMJո?MF7>TrPmոGԅ}<}'8+'Jn8F'5SdDg"TGG)Fj;8^K %ܧ)E0DzZQzcQekU?o%yiDd,$B~(2#?u/z(ou3.3ā/[ b3Gqo:{:t]y\NE-w9_^9{b&G[aeF[2{XLL~XRL.klWDL2KΓ+iN6cµ~.9[Jan_m5+kC}kG⥈Nqۼ^_c] "RՑ"W ! } C KIhG Jpj2Uuѓ2>klFae% Ij;w.7)I}j1v#Eؿa%ǵ."LY[͹x]^\MrO3%:YŨ:SSC__^gR0 z}}|}=>@Q(uc_,gm|eUdͻdoV׸z s%Q-VfPr]O-Z扁ON *W?GڸM&?p@q7[o{8kGdЉ[y%_ofۗ$UDDDurV.,X{HJԨ޺v*Zʊ7NA~{Խ-̣']މӳ%*%*p^h~8,:wڏ?VWcfgWT.(ИyQ!4 xNWcfqNd\7'ʪfeǭ}Kĺ:|H|޵bŚq~Te|[ɷk[fشG\˱릍|mCeOV_VW=E ӫ"R|K^#g1W/g5sPUf%קQY6grύ J/m{iڻ7^<xq7OHii(cڜtHryxOZC3ik.GGc:~P׺qCop7Խz?Sll/dY8u\gķQY9Ƈ_cS Ad*3:,+[U;x.c2&x.;֪,:6^8 6<9HO=Q}! kg2~}9ϙWNR]ZctI$nJ^&[=bHb1Fb$vZB[i&YiВx'#a~掺}zC^}=~v+aߪjzġ(no9kq~)w\ki#'y9w>|đ7n?m<WS,1# Sg'ugڸM$d]zx%~R|.Hսg# v]I~ԟ!n%ﶵu.όJIMvlCJɎzO *A(e#|&TH"2&Ϭ FOgkqϸ7k%;|=ߊ?2=_89?R羍|"]TB^/w5Yp]_[mIq|Y`Wtq>mUi*Jw.K >G]^I?AiJ&M۹X-hbXS.WcuWem4hq(r|o8pۈa1<; %APKZ.=\Fo.=RWyKW-eyIj~guKSH^k[QfF]w)DZBM.xqUn{{*?=蹑'.c?,}L:#`M|CrKuPkYr[BJlə%[PHqnڣd|i 򺒖Ƹ~F+FWԋR'^ukkܹ{CvvmGi`ߟuB>_O_I| ש(S.o /.+6kt!ޞƗ%WV^ƒ'>?qs^ pz<=zQph?dd{k ,'vEޙs2jl.k1=RA(4晏/1Ɨ $S9/.żBLяsb{CԒIDEe՛;^6lۧɃW.V%Qi|)&o./ϝlmODzV; ϫVuUBTRo"eƋ՟)1r83W2)ˌ\i%ܒIu6iwh!i$מSթJK-q} մdپjooʒiv=GJ|q%Ũ׊|mvenoyO.xNoUq).qY 6j7|btdQ#JRRLY IX~L7EcېCUOx֛wKrV$*))pm5ڗs]-g#@-qZ梚n-J./֍Ѧ|Kt3xǶoQDzx-8V|;*{塅荡TukOOԧ< v>v. ?ü*~zeds&LLLwL8ʍtжF6JW9֐}R8xM7.3hVm)*4jNMŶ_fO.ٶx8elּ6=Σ&]ZHJ2ZNN4-\XJ̖x|T0N0f5>_-igP5%am)fgMF}D e~wBzE8~dעRzkg[5ch֤ҿW4isk8HǴ#yu^ZmfQ- R%SrjnE`#á0a.L<幧uF~WDCKjGWăDJzj~<Ÿ|^-7Zh&-f'DB2[g;kX%z|_a(b[mE| ",ԧϨߗɿL~vQ꺇^+IRf,gLSQ\ g `X PZYawY7./"UMdkuq .]b̯ޒ Umi[]ccEƣ-Yrܳl7/j|Cɲc5?Gvw6[fdd=̹SIVS-)\ާ]B޹e+OEDS Le]a_.U}eṱߋ*3Ciĥm*Iz.’f<'"vldۋ4l=.U9Vٮ31r3S?R]T9\_suM]nxF}6 4=goÚN{_mkNc/ww ߗC79xjڍk](ɸO*I矒=Ny.y-ٱ,K(rz+ Ǯ̻)Elۛ', qymJDaۓi$kmI{[/^>4˓iF1UmĒ:Uc865}f.)b3rL#MCCKYR쭮-lT:)#32!  9Hƥ2XQl <<&Ѿ?i e;`pl46VS|vgivڄywo+I%^-*VFtMg R:j+*:WÇ ƒ~]]9Qy?o83a1{5[rk_ǧ,fI&Ku-ސm6ܖ2aEөu#3z}_PmOG^: n>>=#p> n%7RWd_,46 6.)D}<W_<-őQ5栞`%reo_gioLwFat/y64{F~Qk2/"]1,}9/D S3%. `߇3"Um q:,O ,DµM xF]1|"}q,Ap[/qԖ B[qxBobDm˽_ "ɹlZMJȺJ./6\MXIF‘KKdOTʗ<(z$eEgyՖ6{cN)T1a'fLCju֭JEd{~fXޖn~$rM&ߌq([[d|roV\][Dxݖ뽮tʲIne<׌M[Om@y2^ rWjEĕ_xs$Ξ).Z7+0_Hу'y;EY#sؓYB }uU.>$Ij^͹sξmWߨwvW웯iOiم .7"4):T޶y͌Du,y,õaoSZ3O1&^*9 ZK3ocF^co> 4ێ膚5yf~'$] N]xz|5cĒݗ!V~t/H㶏VAxJ"/Tʹ*yO^ix GPuUO)Gff-Hqtۏ2ԽifnRZrsRn¬+Zm?-[&<̒)(J3ZgR%G4iX|%𧭸;,nUOdTSz1Ӱ`Mk}2'!*Fuc-'R .r X?`D~9IDT]`S~lHsİq ]rW6RWvZa%Xm K[iBK"""h>'?q$kn^_M)IG!djI;YA%Jy kQ3OrIDl"_dpIwO{Vש'OK/Qp3^KN2e _5Bnؘ}dh&gd]S6-IJC5˓AtЋN'&.޳?YC^O~4zzC}xz@oW_GC?)E@ ?G^)uW^:\iļӊC34=<3/)3223##23##.f$qy4_m.4/ ]M+'ZT%DKBdI2QC -֚Mln'nm{cI7fJcu>MpΝ~]bZN3aew;%LcoXqN:R88N[4֘&L:m#3Cl+ƵZ&= z#F˱Gu^e<ͷZu%DiRTDde@2q\}qm\C8ӭ+mm>d8ԌÓ+y[%;2i[J#ʒs I&r\I_SISPpIj3VCKܗ\4+?Y̆mܹ7ػudsPD;JqCR{ː;[kL:!ȵ}ITKB\9INȐiQgڛr)gj킆kqg5䟆iRNgfPq6QbVof1g/>;%sT; ժUzu3.NOE>[$V:OW{.-l]C.\Ē̱tzO7BC$ ^(~O@>R/_T_PtzPco: ==S7f_Wɶ7 _d`GpT2y%C%}'ݏ>bBJrI|~fi} {IxJO$S؎MJ,PvVfёT zޠk60"[JQ3g)OCEN#ꯂjx^Kh깞6\1R]S.Y/m46kEE{WBL1N:uY3ig0NzVHzmJ3_I^c.㕅J1O}v%s[_߹f7rϼ"^*}ab3N ƣGfbrVYʊuiڜNy騾VIu?U$6fUǾ ۃOaR.W_WUŸQW<mO{˜#{fv}c:MnUq&hnuiwuSCaȢDco%ju/LWn4Elژ]q97$ I4U\}ܫÍZUZ`.;GG0k&ZN?a5hSyZlR?wj^eZ-ůQn ^ ':ҳ#*]Fq]z+l[ =է[U}<<ҋ5?8<6zl\$xgk~{ߛ7QX`9m&!R5+}9t%>uJY kw_P1O | ~} ht#_r湸Y|kG\NEڙu|v ׋\+9&I]n,56~lf.%y&ٮa3\I0ik0n}Sz+qgmi;ç.PZ"}N^ 'g<\B3i,?rucvKxt^G__>R}7SY^*E?/sP5¡~OWfTiZmJiiZTḞ4#IĒq{ϛ4n2m<ͭu uu&uIRLIQC ؋:>Hq6u\3Er BHܓ)Ƨ˝beJGPi ^'<^\iw'(/+P:+zhiC'qK𗌼xσr;7ʸpX9mq6+ QELd umh/06>IRa1aY!m.'2Zt6\Rg%Ԥ%rl<4dSO4k>F=Kʃrk~^illS0 3²7ؾWC K& L J{j:k22<}N enٻƤGύcמּ `8knhoٹutj*+ۖ7V1s]ĵc>T2ͫmהaǒZcN*ivpI(xOjn]휚t]0pl|TvԆfeSti|wD|R$_x .::AF+x𕱶B9+iDO32kh"b kR$nbK^n-ϩn\fʐ|Ă.x~Fmm\8‚w~)K{I7Ei')>\3ټE&?.YӬu +jHB'3s$t47ѼzEԺOF,&RY@ӡ}o:|)3s ~؟pнGR! ;OO$56j$B}TO_OAӧ]UUrOHJwYyj}PQ]왙 wuidȍA{I01}UeTUzbY3?83,cBs&>hc4%H}ehKZd%$ffdD]G1%*%?;Jyѣ4$>XaI:RJR(͕iϜ4H~/ $SȲG/,6~䥒ٱ|,̔$}H5E~ϝnjmTixrw6NԬ\&u&ŸowƼO<.G;l\ǰW,PƟ FíD{jo!)34tM]_mXFǵ.NY^vܴ^gy_=d^8dώ6W#5v:mnW/¹W1uq~Nr:>jzȮ FWky:onL..VYۘ/_KDǐM*48hq)BpBϮk~YڋjJ U*UpI6@ڎ̖ ZQ46i*/jN?ӕǑD|6:d#^]Xd󭮻R$4yg*9-mԖ֯*ܹϟU\}f?,=jS ] J褥_4P7N ro[eF֩w69ǶP^dR}sr׻SqWo[1_*u>Iu7%yb9鯳[+c8J4) V?L&deBcJe'asKb-QYv4@U2N B:=;wPq?tL,hЖʹs^)>엺oۚ)bjm>K^#r,#qr>p&+㵶[M+/9Ĺ R6JTI% LMGeWO}@çRЀ_/_@O^>S/@_}?? O9ֺaPG>& It?G8OTgԽ~(s.ѼyIuzڷTu]Jx)_zxE^T$k/ hi}GlVobIV~+Z5oNi̯^VZ^N?|x6Rd喾ם#$,z[{׷ 8mfE˒,K57Cjɀ]_mSN3{RNf+[oM2X ]htFIm!,XD_TȼrYaޭb,2;dqO>jM;nKdbxIFL[7x-M qaq9%QƍqmK?{ߕdHu&I4HB]ԈȈϡzLB{X;{5opl֫];iw٭w;Iq>'I'-31"Ԭ='Oyomo9/L{'Yˎ'gPҒp\8k±n,#kG>egu Qe[y%݈[2bi#_/O#?g~N|a)r± J}Mlc Kn֬xVR{ӕ{j݄k%?I ͖?,N! {a :Bx2H~eĔ<z3 ljj selJ ̦gcT^Iy:߹U,Q%D0-md]N//*S~G׹g8m:NrptOqmwKr{y_r8M{IWJ$[#*:=dbO{~H8+(>8fڹ__OQ(sn ?AGZg {Vͤ}ܹ.:/GE>*sxJB$:DKV-L6g/bS<duTL;AǼppfHe_Bf'jHҔ{u'RϽޗs'V %}[`ϙ-KV1¸Wv-Eny!**wp[E]p'N_z_Z3:dٕ cK}k^t7,UgyTr;W %u#W8.n~֍˶0Ç|9 K;姖k՛if/\op%NyCjf]%.#ILJ78A@܌:{50HAftv3(GR`1_nbdK5om{pOɍ1kr %^2]ܭJ _ <[*n>妷i.&cGs>:ݬ] 3=EP}\:xslhߤm#~Y#ԃ'y;EY#sؓYB 7hU?N~k}_zaL;ٕ%yUB j.mK:vs͞,ƼZƏ%{͇15ٍr0mZgUn^T_d8AVo8;Ɲ;ęL*f*l]/OT 5laK8oVieYr84<OSj1 I$2^DiXQvf(.k'(wQE~ꎩwҜ[DɅu-Cյ~*ɾȴ仗7/3y+^/CW?^;l5&>ٔv5kY;:7AKyto9 ʯCǙetIi[9z,ȲLɌK%BI5$ƯJfeF}4mږ>T#v q]x6[UʖT9p.+^qCyU,ؙ l &4:ˈm]GEV '?n =;;Fyn$N`jϩ.Q]z"wHeEvBORM IJ]qvә"8߸ ]I֫FsKښJ$^' iy ;)I%/͂D+:7&9[nin*8 kz\*Fgȃ-ERT$M3Pjޱ>WʩBhJ拓+nSM׊OqKlϯ~,mՍ ~XqِLh2u^c36%6\F#ЎKeI[Ƭ%hǷFZԉ/~F΂l+@C9~'E5u>HVfOD]v &ҕZ*A|8A< l>O?WIW:7HD8!ԗOLS>Q^)T3`U]OSO_zڊjzɅYSS[(f}ŕե6>bqoȐKZFcoJ})GF ?I 6|>:Pl|?ST<5^өxz~w i#>D.^W/_tg/55Δ>Wk"4y_ڙS"i'&тW̓8mMMHu 1f&WwK;WϮm;pK R84SMQ]kyKi)5L%sq|-2>.=CO]aFoCz;NI ڨ܌c霊ңO^e8-s 1J>ZdkK,VQ=RXxעÖSRqO)Wknɉɥ(X|TeӛD7"rYx/RdL6N-1&^H2mf}bJmTR}yFeDDrFl)c9ZRe^ݩ-)v݇:wl!T$48DYe)cc>UۋH94I7X:jdSԃlS8?[j0k{|C[Ϛ0'yO8dwj**^_84d]d&Hm7.cmuǖ^qnVQUꘌ~I(AQ. .ܗa"h̵;KL0,iIJKDCCK.mקO7=^S^exti+~GSj7<=F_' i?G>^=/NG@>,lc#)'YnjݺR"!5voPKѯsȊ$_ܓ_P؛&Oam=e Rc95&xb~$43oBMƾQz 69w@בUQ'f3{4}m=U"֎Ί5{7oD5"t$\F~)tUC{'[Ac/8&"eأ"g{pB|=([Ol$dN\O\ѿIt7/1 Yz~خ+SWR#ӻԶϖR]`o2A{s{< 91Th'fT7.[ͥk' RHZ3y/ vfY5oVϰ&S+FUڪٽQ>eO OIө},{YuG!^T>3oJ])*.-uǗixr46ŷvEEw 4$K~Iu=[8կpX]XQRGvNJkHhmn+CGgEQԭv.}ͻo%/Y~)pdۋ}ueLi8}Ī(q~eƗ$H~2oc$)Ъ~}$Lcv_zň1!Ǽ&f*?-s~h)*B$i3J4*IM*%xHK$Llj+x?䟹;eF#o|} Ճ'y;EY#sؓYB (~<ƾCVxF5wN -Cvmw5< SͲi#(niX`j)j vz Ǐo p~ɏttWDv`9JYvwu.==+Z)&'WL%EQ.)~j\:J-5T~9A]-,aIoǔɰ=~=JxܣF3Mgk]Ga8|{"jKhKRa(Q|]\VڒmڻW .vm S' PII%ΥʽhVu2tt~Tb[[MzUlmjb9yT2 5cHu3^[n{D:9)QFTUĒV] RdI,\iK*#2Qţ']f_r.۸ڿ5>+9[RedTwb\m,Y4̆iI[k"Rɦk4qa**iϑd\HMWv 4Q2D1h#4y% Hݧ)s9Zm(zm.I>99Wq+sQwPt79s[v{.Ap|E22lzrLϵĕ3[vֺ?_8IX6[ }r|4uB6PIFFFFFGFF^GǧSпjږ-m?*f$é)=U8qqy4ip2N'[k##/d-{<,/+䎁FK8Y]**6i8IWӉrӄF~_4 ҃#[[d4 V/,5yz4.Q$)$Q_>r vf;'VWFĕ?Dzbf]>j<6\42A5|X28C$;G*kWCfRDFH+jK,T:k^ǯwk].ȇu$oߧs%.*TUdM@nNnMD&-&Sn-)O;Zjz\rƩqgsSASRhJ[eD/Yoޕsruml,|{8cc*0I$\ñ$I$D.nn[(r&2MIRmCM5=*dy3? JK|I[xqg/R}~?(9R=z}~@5~?_RBľOG_`zz}R>qIChD^o@z]:^54}tSLz̼OgN}S_TO3.tT8OuI~OYܟ7O\ '_G_G0n|L|Kt"1Ozjrؘpzz|)3s >Otu~틠} zN?ǧ%}~j@eW m:qN8n>7JEKkb #/lH-J:FDǾ~<6d}-gAMq$ےyWÓ2JCXPDeYR_!XDBW75a8ٌrع|F2HuBweR$-((1״"J&q=mzgCү_u'1&b/sFXUrKmWySQMɥZW:y]pÓى5..§X+Y%;Zi5t)NZɅ3%.)B գq+6,? hF"z|_ja$42/#Q̌W}N䜤e'WMƷoQDrZ^ q䭓y^}[<{ γ"γ{:9~_rCv\ȏ* $#Lֹ7Zj ^JNTStЬu}z:K21$y՛ϻ"22'#NI4CxhQSoԽ(IQA\x%(C`Hީ̵^;1Z:>Y?+y}M3çY#%ߡ\wa/6rtxzTЃv6k@c7 !(\iUӄY1lw ^3tpSl齹&ϏT+>F#&uԉN-\8h|Z/C'1e !()~DeU+]`poe>[iIad8fI.oLÎ9~u5+)DIԚyOKFѬkM3!~R>0+⪻nhZŝF5pOW[ <+N1iMFTYp>\&)ظbwas:V+a=ՑO"q+gPww^.mN9: :OƸ~~~JW:Ϥ_E>LtmnYF1>+OU<?S+廝 \huJjU|rN)%V{yͬ3^Boxߴ#GT[Xޛ*#9Giح6)"#3%{K8ۋjAoMQٷau9a=SfmB~WjըyiӶribӱ^o>kU)4HYrQ>)qG>>_fW=M'QSdflZ:Z"3~gFfXۤ8DP7$@[QZVYO ֞lJJ _e[a Hu ::-+BJI'.IŪ4jk3˖nF8-4iSMqM>))ʶ}=VUDfuutUm})I[O0KSnM+ITFFd'UCwv#^sd:~G{*-FyJ-l]/Gɟ?*9dỌ%KITw,rkQ^VlꝌCJ2Ps2)BNwsNJקd٧v?ґ\%Kᚔ0ʼ&]kFhpKQʍ8i̒ROFFJIR>#'$ԕ`WZuK,ڍDJ.Sk6BT%HZLҢ4h_W93Oz:"3 >O^@u\vsflL !K+9ɱvGKmּƟKi?pJȺAj6en7!%Fijhz;V纟6z9~]m,_8WXN!`A9C->47hܜl&aAYo}9 33'eCeQcw_hLQ;SX9N0PrM׽V{439V\7N-8Ӱ^)Ǔ.5=iCUcXAYa]J_UDFD3.Wٴ1}_a]N%4MfDKqQHpoKͫtݯrwr.*NUU:F+UU{{}j;mY.SjJIQEQ|Kgٟ2LB,ڜ1hܹlס {$'N mbexMyě&8j4F\`aXtFϹ#`n:h$s!2lZhΨG)#Rٺ}7N"qV1攝bɤuWK=>ܳ6s"vNwmُ-')7rbnN6QK^gAc]J6N'?Zm_`^OpF|9Fz-9A>onr>~bۓQ-'>6dݴ{Sw fYYҫ %NɱۦّێuܻGzTOKO7s'O][SIc{z{!&zt/t{MUh>ģ'WU`S ̮&I0gDyaaزeF|օIRH 8Jܜ$kOOm1rqlC/nڹ(NRT(Mv\4y)Z_alije5{pI$el>dER'nz4[q_cDOF/:tIVr ../XrɽU_4n4M!$C3=rhBТ;$f$?;))2}қ q~|e}rx[XSM%N<}ƓH bG[Jy@tO[J|KrFd^6˯C",*{eٹ -Gmsqzyv=j 0/|ijǹsXE7Zꙵ+T7̋G.1~CS?e\t}M-cvco?z3hOĩRL76r6]MQ*#^$N__A^xΣM,_').\qAW3a6~OWmnUmi9fa+"˸kӵUĎͲh|]P՗VUUN=p=j|fk?%+VŹgo{o:a}-s:>g~զ&B{s.Ym>.U^  QU(dt~U2 ~蟬؛\ozCO'O,/~sV׿0-d:}$5B)[뜟_Fr5w&/ڊgj|I5gd]Q. ͭG>Mh~rNz'F-ڜwo\|*fngrqXY+җˡDG_4|K( ݜȅо{V.S˔iXaW2p$kU k/7smJ^)6yE]2+iN$ܔr2sB.?~y\ޜm, gpM7Iŵ[=/Ξ>ɇ3#~Ժ1amgڑsK'kj̭JRnF⑔=f~Y?~#wn.>L+I#.Unps |LZfU)xץ} ӉJ\%{!ܽ%IgԦҒ##QD#1~O f6Qnt?rLTl!kb0 BRrk4.a%hS\RZ_iNcasA[=]~=UF'6&bd& %YFQNU*MIƼx}#Sl"Yv._tk;;V>lN+^eT2Il<^*A6uOs|ql!Ĭa.%l1w::DBeFQ{E^8*5SK2牓sƵ)Am?W 7&bc^̈2n&Q7QV5i>!+(ԏx>fwlbg2qv=,v!B:nFƌm!%;6lmSoS}fM\˹+IE9Iɤ[|8Yp U5mr8n9OU.˻p)a&LxRq՟)^#X 6vqxil6؎x_l j,0"`̺PzԄӼmgQR⨡u{7]n"^؝M;Y\ӂkqK .(*1>L9+ÈXC]5eLUɶDU!-&rQ8kɱdz\/"0$j|w$)5Tq ~;) I#V$=[Ƀr QMvǎV&i*Ti )c9F>qy{efX^WX.QdkZ IIa~ IJiq-j=^O%s2Ot3}N"tá~^Pu3}~oW__OxשʤO c}zuONq^tz;S?/y@5z~C*/I_O@h^z}~GN? k:u?6ޞ_R}k/*qm/^'ؗӯ.E@t?:xw=?32.: OBiQ/_^ywʻs徙-Qgę>|m 8ƟU,} Q9?K&c|ǟ2PTO˜\_g 6fBM7r7 Bo=1-w{n>눇+5yKե[Ks(IԼ2 Pϱ`2]-ًbzZ1}+N6tozJ5Q_m'N4k'Lȟ"w- Go{D4t˖TsRyffcN-B{Qu9E_\7Fq>Οcj1\;JQIr*G{q<ܛ_5s`쬭 f~I4߇C|v1 %ИNGSSALa46ާe0k ڳ/}ZC?e?XiJ(M Xٶ*C涽/xʗc퐍YݛW}LyU~4TmsmDqGK$Tx#wAAޚZVUg\W:S3!ė ԙ]mjmDe1y%k8m?٨:T#sTƷ5U+^)&Kz_ZbKpsW]wj̓O`=Srk!#iвOAXU.mA"`AccTQO bRU[EutLlr[)/_]ǷdZm[^ID |O^3p}i^;LӔZb.BIDeFLf~.epj1<<בTfDؖS8y_1xv䈰i|HʦڙVNB^^2猟-e*61MGiyӱmd׼}\צs )q^ Ek%c;aICkt0\kݞg1\œeSɔ:NDItݽtlR`7zGֺ66_GoW- e6#1duMũFmۉ/1-9Wnq]c%Kyf7NSsrn^ǰ1õKֽ/WT|拊R(jטf{øN}aZ"Ic|FVhZ]q_5ZIJӋIӦ͗cc2T_>|K6dM2Jjq\ZZJQK#99ɶߋfQŋ,X"DžvbCE3dxcICmH~>O2]'ͺo>iOrc wC^oS91lO1l2rRgǐq0ߕ$iRM^7VڛΙem]qN';Rs}I4;8Oՙc-muukKgecF8Cżb.79U0Ȯ]F EAyѨOTG}aǬ}FM9j?/ÉYl[U6 /b9Kj_w.ÉZ`_i?Q̿[Rܭg 52D}gk"XMڊ>.b! GV_¿%͌FFO'XLq5Xq b/W):t_1d:g]w=ĵ{R-acD`j=ؔuFWL!rݛWSӵXʮ^KjkQ|bS~}9ս;W8(?%ǙںM',|nP mX+K^-gثKnMOu( &'%Ju[Gա hs]F+ŵิëeBm-V֗X6vƛk1NE۵J\Ž`p͓gwI"uvQd-!ڸ)jGW1G-5)$Vj"QFF-QץVYϵJ=4\+!0m_ֲ-&ryivWlj\kYg$Pt]i\zZMG]GfkQG*u2Lv/S"i}Xd:z[} i#;˶{j^Uo-{Nnde?2.ϧ|VNb7(vbwh=;m2 @Y뺷MF"J5I#dEڗTƤs]K%ɞկq0Vbi[ڭҟ+7&iWɍV]ǔ$_O|ܾulvq_d}2/Ebw*ȓ~7?썒:ЭqcB*[p!{|=˾V؝c~ʌ\eݿ$(nʯl]Í%;kKW{&,]kdYPW4 p]y/kQ1d1'6{ṣ&ۋu]~q&} egUΛ5iYz}ȕiIɽ(׾6Œz+VDWbS_kV'jjk:iJp{`EB3򑙦RѡwaP$/䜢0c/,[ou\rqkߪ[mU6^qisQ&NMv:*>1b2#4ZYV\h~WXQȎ0q!)i^6>m6b~VV^E>>:#кm=4\b6eO$kErFݝB*f#[#!TFwWZt`ך:Z}96֪k&(N:Dfۊc^5M'Q3gef;c%_t}O=a󦺥_J^,NVruJхm8*)(N2:?učSv=6+ɬ'86M!W@V9 OT6'<{~}"mssn~MQo+hjW[}=}7UkkX hgvv߷m+|<Ω6@\C}{#sj Z]<}%쪓~ÿ֠m~OS{JYQ5mO]wm~ K /b;Kj_4w GCM>(}w/Կ }ܱ %/m|5$ͪ:-^LM>gJյѺӣ&R7dq5;WTD} 1f*.ZkN&~dmNܡ=oMFXI&,\\d^VjXYb^]|lON|Z?MJFԏ̯t}^q|[: .]8m8wvbϿk# l۴xM'|{6ۭx9p,]⼤qJM s:ݻ9b]'_57ؑ_fggj+n_VKYӼ:sKɶ؇-\+\PcBxe9q֚zNq"`3 F-F(wlHj EѵqDw7Dqa,ͯ{0\|+& P~Lofw&M#-&i0FXw2pךvm7Yh#ib.bY?w8q܆e55CʁgU`a! /&rjiѧz|m2fB7ldc܅ˌgj(N/Qm1#cfuewRG yf]f6aGꕓI?3ϩ&f^wg~kXGKR|!SdW{o u >[6[ת0qqf+̺~N&:jwq\յi5;-۬JMۓ뱰͗2y\maՂL0M\m;&u#)K7RD+Mq66_9}kUPQeޗ{(ٚ.sX-KSV>nv,id&xۭeߪQ.D|Gx*˘O 4*c.5m=&cw~"Nd9JIqRj2M[덌e]b^c<+8bJM:qni]r99W.ioȔ/jyq]ƸOżۍQ6mڝ;m.$2l&~ΟVAQ"6j5mX5d">_u3?j=O;II{J_ \a1;N)..Ec }oʞN޾Vܫq~ MƼ++eiXV.1Ė6$_X`r[D;v,QIͲ q8&.;_e B|PC5]OYRy%֖ԕgٺf\u Rzۤ%Fjj){6{QyW,dW-/Uqrԡr1\Pt2 /'tNrѿH_6GkGЃ'y;EY#sؓYB >6LlN[Q-I2dN@ѐ'M.?F^mKnݜosrٙoHiuŗ+C}ebXJ3 ROeE be&eP_n8 >v:ha籌iK(ڗqPF!VGipKS_eJM'>>sui:6_&d׌SU#:u|Iܚ6r_-.pĸjSjAMȌzc>9uǹs|v2n":1|>RR]KGGF4&[žgnN2O84Ȇ^5RSȩ)$i_}}q,^NTgz(pަ\uđ[cG#Di$ˎH4?5Dc1"<He_iYewӍƎa$90"Wؙʛ"?<;`J]9{?`Jml0EУſed0㠿CRДB!jv7foŨfP3o*NNkH훱`\&ϫ˞tn͝$*YR֧%Ey]}}z/]3w1jd#rd~7/VuuqLZPW~[fQ˜[&ۖť/V_k4#r{.RF^վrwO{Njn͹GQ{vCiݚ~En-D}^]-F÷]KUXD$)hB@#.&L.۟֏[U^6m2C%UDƮ[J,"k% ԺntGH25Kzc^ 3jwI^~-}xvvg~qyq[7)dL,ޞD;I7̛%T\u)7XY5-%ɗOHztHD##/)(FGFD^1]_XΓKz?zi}'Ok =~B> !+5tx=O_Ir0u,;5n l݋C\&QcqY!FOu6:i!W#?*$y]Wngcw3 qrm$쫢IDtt;n.Xdl캋hk&^9FXGUH%e_iC ];w'ܗ6e6..u\l*NSi*)N[!n-86e%xF/?G kӧOzV8qz||=O@?dm?OD}:zz}_}R!:z>PD=~R/O ?1=="ç蟭`>qu]:@hj螿R}5_<~"ק>AtE^=:P=E (xxu^ :Nav\fErADpjR꘣_U9+9NiR!#3Q"/RrIwpgdvQ'c]mò)ѠFfBnLiIK2=<.n6ܵhVbZoV5 yR]JmG$zǣ|9M4G~^=*4iS[Uc"j[Nr QI[λl*#O} _H{gc5t἞n9fKB-兽.2}-vF6•\ 5^^ieȚMRHg;ۗ\sjvS}ssXYݬksQ~\mI('D~]Ż7_y!V*. Z5!)QePٝ\Ox\˞JA~\9SEXk{稵k:/^ȸ:pyexf_<ӽ٦+\m\X9*8FI/ZZ<8ΣlG+pRVmNSnb.W1m*IkĬjy4 ~Ma1 |df0d٤D3[DJҎ3+khw Jm:Lػ~)C*_5!KBE|ds#)+w-R6KLȱ7cr;>$ߦ7k;%5n?@&n}og%ܥi5lsct5uOC#vQ[)N)JRJQJRL`wgo8߸6G ѥ?[ʷ@2'/ηB=1f{9|ӿԡp%W R5NCa{[V8~{[wUDT8+oƐҗ\Gжd0y ijIG7Iͷid. 5M6ba.m CaozYUc(KZrܔnZ-3dl|krjJƳI_r0.B~5)TdiK9J>jV}PQ̶]m0O.[ghm۷^sGAnm\ZmyRR둛a\K=sdG~#ŔñFu$}wY(*JJ-6\}JY~Ĕ4EEEuMpk򏂠x\(n>Z!Di-Zg&ɩWɤyg՚֗%>dSm%Էn3OTKˍz)xǶOVg[}5-qܹ*(C/f &7n|4IZ?ؙ˪./?m #BilQ[BIfK\R-OW iWs.*UsܗߒNv\_^GQ:-3j]27|I^)>ZeIسt!\oa6ev7٠gbm[O i{& Ik"SI/k;XB aȯd~zgMҝ*+}3/2U<켙/2yWjnm۷H qa&!s{%#ȁD˒_0m+_mKc]r}54&{rqxN5^$5ُ>[J{_tn݄ds[0fd8ɨQsjtT tcG {qn?V5[^3fij dy͐IC쬛i$!sSO#juAv#Y]m̳'ڸ'%4/i=֛Z}OUE/^nWms Tm {4'W!N'm|JnD"sKym璓v$f- I:v3mBurmOkju(Q/rp}M8h?u}5_NkǹʲpreA7v2ivܡzԧj$؆6f'WmaU5{uJ2vl;Qq_XcEtᔕƱIihwv2`C0KҌ`*ơJRtDd%g-CF]]~fAS\*p~+A:n_?vTUWO:=Ki\b+uehXq]R 7`6Ow.1'YDԨ]m\r,zMͮ{XQuJѫ΋mF旪[vZ|Ws]ҋhqM}_Nuoaa`#Xz-\<|urf^R%(JQAi$ vjs8퍡&RQG .u e48Dvqٚ]j}xT|nM}o}t6K7Y緥iKs|]KЖMWʥ pRv$/1OITq8>?YDRdF22[-rJjTRDXSOHA!YZ6 pnҽ&:f72ڪjkTnO<ˡ^]~fN_\5L=j.1匣 7fsիV}۵7)yYnd$7W( ޙ{X8FrAhĭXm!zDXsUejz*XWxE%3^г[Ұ-%̭ƷoJUVMwݻ9Jy`(Y</9<7&Ui63ȝ/c6dhȼZ>Kُ; 6_&25}8Ѯ~}OK؄;N%:R?7*.-؄rK峀 bKbOdrT|c0wXyqAnڻnK-^V6WfYTMؓ4=:Ѯ,ԒC@>P+oVZ9[_1N$̰Lx8+iy_ŝeSg,һ{ ~K]V]s\1J.s]!).3Cm85sZu \ҵHywm>>]ҋhqOtiHV'\/7L!7l\.[v,KԻmF)۔' "I@}\:xslhߤm#~Y#у'y;EY#sؓYB ~<)%pg1Xx,bҲdOSIKh/D,5oydݚhe;/:PuNjb=]k9zYW{ u(Q,=49~uR^u!abOK]͙,~Ks{5Դٟn'=}﹖qH}VHu8e)Kp[#z#fܘn5wK3_]h\w=/Zڭ=n-Ÿm/O=9WqKLpmA3I_٥NFMFhe#&e 9]l(&T2}ePt/MnWC_Tm7Oe0ܻaA*yhiSarշX˒J-?n۴_PsLUMqEQY/櫛>afd~f|sv}no  +$nZ"3haOбN0!}Ҋhce\BN/Ly JWsvWOyqꌞODz_a}26~$GI];dD Y6uU ɪAlR"JI\+Kʒ9FDe-۹7(SQj?`pS4y7ƿ|bmCW>U"lE-}Kp΅}KQHq1dE  6|n6IGEkR_fG7ǡ"P^ٟOo+vFz$_)N6Qh{쟅!-c9Cd`Qv%k0TFDi^} _;ڽ-׏nzA'o6V]yٗoaWFhgQţFJ3Iu"cY˂oO͌8ՋOyn 1԰j?lqǏEocn|$ #Bs/\Dw*Ŭ/IIT+1Y'ܲ"?S3qIi2'8ά"9>ЃǢRV1>m0WXޘ򒢏`ɻކH|%kwW՝NӂŚ {\+6w=;L%I? 4ggZ7cp3jQ꩸:SW78YNio&'Amώ٥R䡉ݯR| ?f22}=%O|'PjeI>O`uO0kS׺oO)T@/jϕۧD,kV͕oɐIm#x.Ⱦkq)\K32K/:9륻k8kr\uW׌WUw٨\{j쨧rgD*/V2ub*?۳Uܗ9EC,2uXŵ;Gj_$(>i*; S\RS!>sv6y<{b %3Jz-1ABMo_kZlԅ-J RJB/˳,|+('|d_V$nc(׊W}mdZe}eկSen_M_cY[Jv=nfiJ. ))QtRH=Ch%!WTlsհCnl,! w/*fWd{U|q8^=cCc.NXt%XH4ޯnyy^BUZ+P\ߏiv;tC|Sћ0mВB>$AI'":ȧyƙ'z#DE:r-3.i*udET:c9]a:)_fQ(qz.^\[^o?ͱ9/ι뒷e^ҕ؏޹O6%uCnW\SaUGUڨ8}5]Ví2rudJnuI%&4tr696ŻM#J]]HϴNmfqcܕWVRrj0~]xKu\㼉ִ,=6/㽕S}W[.ȕkobCK 0=!u&+2kJZZTf!E22>F0bEM5TꙅfjCMÈyN6j%!RT_ 2?G_x}ޅzޮAo^Gsӯ\슧l2Uн>x Wx=?__?^:/_T8(~WPn/ QHzICH>=]V|qa6ƃ_Y}MI&%\4xܳwn[Mi]Ù,R؆K2-hiQfZ+&ctX!W5ST*,rƫ*+ 4JZiB ԥ+;fNFNUdeNS7YJM7/8V>$#nR^\<PL0˶WgU9_j[olBW7+[:hBO^T66RSQ]=_WcuѩodNJҟ!%Iy"S!]MN8ISQor%8AsM<='B_nLc@Ԣ&W`(̉ 2-FdII Wn"o]JjBUe?і^E Z$mT?Ćil Ϭ86 v$$TG飧>*zwO4'K8-)NNvܮ^7+nw.JSl)kb8mOLhmz7kPJ/2wuC@ԭjl.u^] /FF\6:i\5j6f+.614ݬ\IJRd9>cxس{jtYm]^F|Z/QJRdlXSҺ㝂3-W.{2qsV<ק#fښG-2V"TǵVnkiɫW9. bxIW6#/lʞbj#:Dn2j.RLĆ^{ߋQj2Mw4?PzFkV._Vmw^%;wބnZnKr%Ŧ@;ľXn\{si룇kXCȱٮH^3<-q'DI#Bdwܘmq9z铤Q;5ޟIE!/htK}6.7}9AEd(k/Oӭތ\KEѭ\+œ~#Wm]2/"U q!KpK&ސ/zGV5]"̴Vq$q̸r V7.u_ڏ/=Qw2v;MV7c+ MsoZ4da\vnZAcw8CY: ǭl(im#; ΦZ!I[O}k"RVI Nj틲z.3qZMw4?Oz^kf6߆V&ew^%;wl݂jŸ!(ME w/#m:OXUq(U%HohIY Vߝ9*vp=Hҳ5JΕkܻܛRrlԭjLȿ%G)Rj[Jwݔ,XWz!UybbڣOǫ60ó'[!L#89Vԥn/,%kiGJηO.U7.y/ Fqm:VKQ=ԟ֕[;_MvIx:tg7aIFM.sJ㍫7v^_gEkfY}$6}~RR$$HBRg̛v윥):I~+nm-kOt0f*ڶaEw%e'YI6u/9ĞVmnn_wjk2oJCc%-.ɣ2e"JJiY[Zr մRp(rBk?4d+]!u>>J籑%g3Oݴ_\uJńu7y afva e+\YxJέN6K" {e7VKhZDj.VzcO_^Ԓjmz}:VϵNN_ƣjt;V:` 4Y*)nYXl!";_~$.+ǓCJaaF>ˤJBТ4*"22~#STkO3fc%8M)FQjQditkW1?sw?&˖F8_?҃'y;EY#sؓYB XۢSU1M_rK,_Oo8e "˳ʹWsv7yR_4-LҔ_pÒ8^;qJF1ǰn۟.Mw5Fgi9q;Waׇzk}[CiLk,LweCT;K*$؎IqgCu /(o:-1_1p Hi6([)([qR̉KqҶYMܽPk{{ ҧ ^ ;Uq]m?Y%V书{'}$_- tȝczI=Ƒ(5nn)y2XDzml3ER#/kKFHDFGԏR22ޏZ/U85z}n_s_Y|9;$O_C7^n-}8N4}ySKjO_Z7vZN2q4ϩYPyWZ~k=<{%vk^\AOq-B4G蘆 jQ$A)pM+155|L3W {#!aJ5i;k}cHiMWu':ksV24춢Իh\[\~/ml>cbaw |F7hUƜԫ]n):3ݻrJde*&}KMmYnS-i-Oɢ%55眈5*Mƛ̴vۇujWz,#O15c Enc-,$ddPnu / ƾ|NYW/B]8I˱U6Rn^қ"@rI)nf7Sk9pd}]-xTjxx5:=:S@6u|7z}gzzH?mz3?_x_K֮C?$ٰ+n-'@ŴؕTnI[qlo>PqnV')I$Iv_mȚbm. $}DigUIS_eu{{=ZW׶UWGITҦIYb3+YI=q9%qwkxOYL$n7ɍM_#INYx SoSm?\nVwsuLӥ,] ?JsnH4N,>~Rr{78SbĮVIVq@qDZ6r .YwIG4X1V2CxK=YZө6phbJ]z9d/S5:>-+s\)^%.I .*Wk> v{^g; I9lbζ$ȦM99H>\vKЖ^cAK;Y8M?])bUO{u)wc6ݟ/ވLh$`v\LWҕd>U{s>GLcׯB3AO]ϧjƒ~#%-g<> 澓k73#X8WtS,1y݋0{މg;(ڦtpk"Bԏ&|>6U]O~cmyf9^t\.OLYTj:|=6"10oQ_cj;Z5BRr:2t8rXa䚐~e]1uձ[Vkm~2& A>^]Di;HijZm]qĒUny3JKV7]Cy3빺\\zڰSܗ^^Ho'&7'@p4]J†5 bmzȻaڡepGoB{@cGc{*fOkEʋy.\gH]Iʘ5tY CpfJud4ߖOVܐȕ1s\m\&O I#Ώac+ph{hB(Ʒ/c Z rW[WB)yX!+]AØw\*߆~V}ZץƬI$}R=I& (Eݮ^ō-z)دEvAW(NOSe Cm:_ru'"Nҭe/I®6rlr8B=2ٻRm:Lq4VSl$VcoK8v23$O>D4ɝ0ۂ6eLF'͙jTU'Kvkp8ygsb94;d#2M¨ڕo^l*ZHm$<)ulGDYXMyU\I.~h`qȕ:wtӮ: &|Jm8OSIAH$:\Gu]\˧dӹ-CxvRڧ#Tqe yXQp׏زoX.e~Xmr%}0&uImd\ܒv>7O};m(sȜ7!O[Or5:tzÉt0$v}۵v1^2 +ÏڎVY5͝\g֪؎ΩnI୦_;1яmIzgrb_`vv I3`lE *fÆEVeZY;%}#羦zfֹ3|A͌>c[7eeR]b&%aqY6e[WVm:>H#ZL7>'L6#VKUW.ʋhcqiM{~Qj3S.x݅*skUD*4u!֗s&lh*CKRBp[yNgSvy&lM.$BDy&>өxsWsǒݛ:}0}.ܻrU)/u9S.N/ˍkQ>!4f+w+[4$̅j] k:[JgV4z gxɎͪkcdM֯2E/I%j ߷5F'*RIM%Bϋf`jk|#mIB񣓓MvUM:25&fKŝAu_ʢ-6+\]TT\,TøhY:vUSII zRƴ-ƺ-F1VF!5dqBLPa>Ob$$]$ɌS[mdQ]Kֵ?Q fzc܅UT+ÊuI&tn!Khv䵶luZ?k7ZVlKofe0~1(|YxSmy8e<|IɡB?OEt9cbqn2%I)/<ؿE~çI_˘s]..w KRPbVf}ﵥSKBh "dj,/Y&#<{LP\؋ym&M{QNqZ󿋇ƛ`G4lC{$6,lX6G$ZM*U;Y*M_^JR}oiEeyeX,_}cl1ܣ eEWW.Y5[ J]QdMDc%ۃ> q+ 喐~oq8ݸ;-H3WP/mO#KB_{mrXmRO­}%غ?JŒs-wNĜµZ5-1w{v{fػ->fG Й}ýRpSaRHJC/ĸuFy5$+*'K.bN9ХmI$ۈQVubjI8b۸d4~ >.eE,́6;2̈rbˋ%z<5!BhZ DddfF7VYXXMΪֲ[l젾Pl+ERe]B\iJB#"1̣Ei8FMxNv[n2M4\SMqM>)c]_s_>+JHR,b:ƾs 6RRaԦiĚV4O|ZSq;*KƏWk'Yَϳ2f6bI"K̊Lz-7Zݎ.Wk^ߋZlMICB&BnoKv5~{+q{S/[Ws=}[vz1+RaI̔Jf!]IĨD~/YzSG- Уz闙5t3/$dc'[s c$3;&ԭǓ|]9ÚRkOam^=6n/tm{+N#-IE3AtEI7Ch7O3> XF䮠/4۩*u9duCn`1B%2WC2#滤 [ۗÍc~#iomy|kH;n-]iOKѕ]5͔}.Ν *Y^at6n)PٚVӉRmE).t2?d-J<>%2m̭z6 ˩u#>=>\~!Ϥ O"O63湾KAa\/ʭPX4$nA]T}R̒|c˿lX;&7&E \id['D|ҩ☦Yex&uf6h0#eM TT[Ϻ(FI$6:JQvS#^ȤT٦5.bwRAĬibqA'SrL̛>vr\-)Ip'x*TO^N5cC(nIGudUNƎrTnS]et'MJ&*s>NB.>fy-i@omQCvD:1kO۩\rC)ۙ7&,x8P:Mv7iU@r4KiWq`@~(D vzْo#o-W&[Av}KVqJ83m}hzӷok ci'\KGnݕrJ+>dU&,tӲ쬤S*VfDmKQ$Ȇy߫>frRc598}=$Ɍl^ODzϒ44~%!h8׵eGv\^_N\F{DWu]<9dh·>y!|;}5Ȳ_η4}xn<́KQ pwbW3bsNU˙A .ɾgڮU'nJO#!\|iE.5q}{sMˮ{A}}TԛW;Ced{A/-R &G-ppn1FS-ƢqJsehUtQ%1(@2]'ͺo>iOrc KпOmF^6?iP]v]]Ռ zxmĬ+;),1R^}Vi$FD*۷;Qrri$[oI.-%usp+ږz˷nN0n";'&B)sQSm=كmun;b]cS^d^۲\^ TO̒xNncpۘZ~%/jZ%H;qBSpޗ(w2܆)'=i]ZdvR3\yŸcR^~y4IMNퟨ-HӶL+6[ŷf#nbQ.@} 5FQ$@8$tK8GL.=)*dd:ڇS!1ݭ?wX_𣿐? {FAv]vJ#kԿ;Q^;/rќg2wbj7VW :eG^o뭩95 ԣ}IIQi>eԔJ#FF^8ӌSpٔN{H'txs&YqQ}!+MjD̈eO~#/_"yߏ^gQ~?Z,4,_] 3TXяe7[x2-Us :QF hT;*]W;|\)唛n-({si"Q'JzS$mstx_>MnoRV^(9>i.'xuq.ε1\]b]dlGƱ/U@- J(Ҵ(*B}$H1uX1ƏW-]!58:E ]45l&WWIL38ӨCIDFB,܍MPiSNJgSPt^j7ms\йn\' 'qn2O6?'wetH3\ jqM-qSw^ɇuH4^?2fkۆJx/'dOa[meptŸŪU2I~Ӝ> !C}!6^49m~%ƞ ~b?$0VrNƪJ6_lx谝$\b=ҏN,"`Md'.wrʸݴڗk^COdDFOYGq)Q:11/d,#UO%qN1o2n}gn4ˮ1n˵qWsjjTtc8Iat|0ߍlΘMR?HI$aqՑy8QO݉}s/ԯ;qyiu+A-̱c!ӵL tG=rO{ݝf/dht5V쭪zXpڨj2m̎^ Z'āwvq-7>5Z&mݳ5 KǛ.td8?ݩ{h^1Ӑ;=k+j6p"]PrJnrmIP N~p?lshǜF}>`njHVnS[+V&}D\|$҈\5wCVgFJ8JUpS]TTڋf0, dXQmRvG%O2K#{c3w{BvdVyrlg 5Αkl!2qDr5kGj.uJ3j8.5ʏԘzy^Əqغ}wYIRSO}͜.@cTMݨ0=oQmtV8Lεt2_An굨WyRQճ/J||ޢ?k ]:xUzX:;+4v;>bz/8w[_)6zERLR׸i4)r-xDtAwh;V,]T)z#_Mnk5ʹyזxUÏkj.<\ /0dM8*u|+BFj dq z9%)p$:iW͓"!;ܛ%dK'XȦ j3~٬{!q$ؽc>e*JT{y#پ5}ytIs5$ҫ~{?qw2<v~-8yKKY1lU7jm">#z͈wD}I$L>u(o?C^ 27! udn-D*F7B5(yK1S︆ZO$j&OSdxu3"7w~p}ο[gẶ}{ڰrkT1=NmIKsͫ溦Uפzm1NgqNjqɤanhzNj\P~J]p_ @'>psB QYFDY2Xڹe4! +N8cM%AJOCp<\kWAiJ7e=V#=ᶲ]sSqD]:-S.Rv'J62O%ݿ.i1KDyb9Nѷaw4)v׋Q~zI#o{7 6aJnEh&bi),:5WJueڐF~RZC܍CnYv~oigW;%3DHފt"?ioBͦ۵/J/aZҔu2튤 AF/LqpWi>, e|nR+nfqdL:["mI$yI$VB/F<^wgo8߸6G ѥ?[ʷ@2-/$˕Z }ʮ>6IWFu"?GRs׸Io $c7w=zۑxޛ9>͝vhxkR NE'Wk/w>tiZ֑/c+1}մ/]@Ac]=žEcX0\tnZcwr-(wm>#dr[k6~3r೔ҒNY\޼{&uJQ$HSro{mt-˓  R߅?Zwb91_Ǡϛ/C͸s̹3LyVUȾ>ӻe}U| v8wɿ5ՄY{ 5n:gQc!knu)_;#zga*w.S;\ 뿰&쏲e-;Y>͂~UqjQ𜒚Ʒ?^(.WnF0bՐ ޵kps[iz'5JG'1y# d[K=ρ?r/ީ'/LΝ{9o}au Yu2'r;C^tƕ;gF9:~U=0,Yd:I(Lbm{KN?2XCfx,9R#`i%N)IUz8 "l5b NFK5-]DxƳXՒԗ]f_mmY717;A#?I\ğ8{|}l^쎨`E۹`dJx5wMɆE6ߗ=[ʠE|kjm߸ujug2;lU3WC)W__^]5|?ul?n[h[;s}E}s`f+j9$>%Ymi-ҟÝMjHf^&sP?nQE.%Pdmފ?V'lnX.ڽޗF-k~`ccKsgrYE)tqFr[%e8t%=3>!oM>:V0b_7kI32/XcU+c0F.l/cٹݽ :>mN=ח&O}eS^. Q6M*}>Zc4uJ\>KD iPż%(ݷ$4yc[n<.ku. 67mq Y0X%]5*q2fN=sЭ.#掮HǛكROIg#]-1=OgXů,@gr&>[ %zGLW-#*OHODInmZ%<˅1]IWmK;= p'>;k[i*EU(K'Npvw G<|4Gdd9\ һb XEA!ſ`-I2rJ&- 쭦xkyr~enG73_rXn}5uq[6ٜO;+Ȧ|o m˘ƼVG=(ԩoJJ|=^\O5{9k"OqnO_+q*3N6G:]K0mL9W,hAceU .+iQkae%^ڈٸvʶd+V0õ}Q^cdb"R:& vIrk D{xY5Oc O7nU.Uվ<UNlIɭӷeJ0/c>vE}ZWݟq[ 2!nfk}I{!|sTZggl4%Q{U3(u8WW~'ܓk'*hcc098OQK)M'A~qOInԟwzcG,nIx$kƊI8JrǯwOl~G9HjE%96\ҙwo1$Us)ƳJ>MP~q }>>eSa̻c|/#ה3RG#b5x۱̓'c9%|He?y;e)^`L>͸p姊V cvݟ M9_ư>&jJ_< H?Th;")#%UI7X4]bsή|hs]g*\{~E>7Ԙt FqZi436W{gMg6-<)y^ZJ?3mﺯ5>D^D6͛8cfT!EK%#Z2/ߖNTre)6ߋo=1?48n1QصD ,~*|)j'dz=7?󯉻z3q hjY6G߳dFDK)L|K/4,' -LJm\էL,|Uz Tt||ɖk;K@Gk簩 t̬B[mLxjKV1M zC|^(jwvN-5q/&vVQWTS֥Nʕ>cFA7mRөzN4^x6\m}8kX:FsZ|.)֢hunJ=k3#w~OT#=z{qHks6 6÷y"ZYɴFǨ\2Cŷ[&_'LoGo=ؿzP'Ko2i9`uqNV1uc}IQE]dFi-?j{>R甽gYXR3ίZ2~FKڗFڵ~N_DlGdK^hjø11Tm+VOևfG?$ŗ_v1i\/yF9ssEv+O~wzϸy я}SQ&~ *!$~Q}~笷]z-Y7ɝ+[2Ҳ`5R.9Nb+ b)=./?ט܋Gd $zkS$STS_ΧG_HNkyx.GntX"1`򢑔 'sDa'ٶv-JD!+Q^*4sֽvq+{GunOOm]X,$}\:xslhߤm#~Y#փ'y;EY#sؓYB vˆjR&B˪6|e-slKV.Ҽn:Y~ȯ-d_$ߍ'6[y;,VҐJzNV_v[oSsXY& [0lDM.=RnE% L/Q g_ QO'&M}qȗ4Qo6¶~_"GTW['9$U]8W?.2d$3ZLjzBO&w stkls2z~4l׈rMw0i][qX2fC/*[kn8u`G!~+sԛ%}j;[7he&ݝ'ūv%mx4WwZJQnG57u> OFy#u1q N9)LO/ʒZr̉3I"K@f5M{Rګ(,nLg&_VIe22z+ηקR3% Z^m;VnN-w8Ŵ_<2%QzZiij.y_8 Y ܚle-M=Il2̉I#I^??.Z'nlxu<Ơ8+a!} +<<2#2:.]'R_[;)U5>:Vm(7K~9eĮ9NGF&6+L0n(Y"܂%{(冔eQx \"\ 1N wne?SGHD[J^e}! j&O J -Ņ(ezd{]{>MXYC[j}nIps,^~̝)A/vMc$YZS1YjDYVCJZ³]{CK>=E](&,2!hRT21!rZŵ$4jkmܱE/u4+g[!1®ƺm;y l[zYyd4҇̊.+K%DFB!8{CsG ,}y}=AZ۰*kO-,cAI63 Zhl/Мv K\r-ƶ4~,Krf#7ao {ܕ/AvzsVcw_o)䮰%L78r)o, fz{L2|_d6<|s, n,ҩO٩2{XroLk!O6uC/j&-*&}~1e A=z>}76<-?TdסkmK \К⚫]b4]"w]86g7m"h6~ܠșaQs SafR?Ow,kdxfᴳ'u)dddд9Ҵ)*A,WIGDKz|yIRևfAR"2!hZzTR21W#vARӦ<2I7"j)"v_JmKYס ?Y.;[Kr*ؒc1=Ԫm&9|kݷU2:xAicj(j!kmhZ) JҶ֓%IR|HHShdJ##"22d~$d~2c|nYNyEi/rmym+5ԒHd"$Qdzf8P#%yy3˛ˎoIpK:vN±s1zl/jbb? ZxIEy[i)!cw ~r@lGĨrԤO2jOC#J8je(IN<u^>O4u o6K/GT8B=!e6m!m,}{s3I6e|Y;nY P>9ft') Am=1>X yrIt&!KBq>uqTǛh٣QIq;o?pmmgJXo+dW^nyg"-z5r??_0?ވPp3iKCv唘i=" L6Y[Ƨ}ŞeINDKR ^VS3iڜOIR}Vli.3}W2Nier7jƬ|:rk̄aYQ%t`S[9Oi MsB { My.;.6㍗TC; FyU>&Qb_P䪯ƟlNt8K?VO>؛{wr_Ne SX6VEԐԋ* PE vǻ'Gdyc+X>ȱě5:U{\m~eL;ƶ[#ujji&q2]QfNQދҲu[ѯ|~ɶ?-ڵ_S+ԻB37Yt!]>_PtZⷽn)bc_fEU_;,ẗEwr 1)-kQkF^RqqO^򑗨R[Wݖ1eLg11]CU/CyrOދVzT+&Gs#&YtL&jʬ$+D/1Cc:eT?9<x'_+k4|<<عo!/+.RT͏"Dmd%2W% E#+۟Q%}d{ͦHrZmIY4dROCmkMW1?sw?&˖F8_?׃'y;EY#sؓYB j,W'R[}]`HOAQ mGu5 N~흹{hhccWĽsIql܅l]0wf-/vAՕ6 ԄMGu֒ESUw.KL eVӧW!5(iz"N}l4e|5^w-u"J)xnj֨y.9k,y:ђ2Qu">Dm%r+Gk -qmS\eQgfV3:nyj Dig!0&{) `! z~nELKyr܊|b+ú+R癣8s28ڿ(K5%̓}ũ$w_-۳F՛{̶2Tb;_Vyr#3ݝDuRoID~8~dKn7Bs}~G1>k2w_xя;.dMk=O98dB~! hLrN.wLxmQj\ٸ|S^:/㪘qde̲~nWRf j;"WD 4D^`IG{ɜOCYϹլu׻II㝽:Sh/풜qJ &}+zjTTs"y.5~*\Qnui9a2||i]a]U5*Qb)6ϴ}f!fLZij{ID "LiQg#u*u.ӛ~=|薔fD58ҏȦ,,,!yF5+3HφMڿ:5(1TSe0u2xf_ԓUji4tXVZx譂jq,6cM&KKiXOn=mYO#3*qg\0dyJc<畸ZoA"\FeGqs6bb-\ڏ~.ׇcq~-%콁g56*ٜΑ|8VMr:&-Br'rKvֽ"?$#gA}RN~I;H6^guܓ}hͫ}ԴEDih漠y>6姽zܑPZy?pJd룡)E)iA{ǙXoS8:F8Q[3kx.BEҳg c\.-%#vR}8 Sz 8s#|EI[dkG2^*m{խu5(_ܔ7e_|3{d>Mj F%7_4Tӏ@uԇ///vl<^XۋWևbf_py 5XM_G7"Ap~JIř]$LU 3?W M̚_K=nOؓ6cVzcmo{۸`'ikVTcK2ʎ;R,3F0}MKd-Lz8g'2]'ͺo>iOrc |LПO,E^8>C7_}@FBg@\+aa;7=r8 o]{9W0'X^ȱNb|xK5l>tOr=^=O BՅ%t(l黧O͟Ņ|߽rQ޶wve5ohk~}$ 5/3>hFZAi]c s$3.=&iN#K>G6:o~Tٍ{b\NUE_*!h5QiO4L:6RK2->͐GY5 Zꢹr[*kGuct \00rn<[oiqU8"}[o~nͤ!vm jbi$ xֳ~2޹sޜܗg gb8KFҴ)%اjA(ȵ()_VK4dzSazRJZ1W3N_,CV۴saOolZ[vg[91COGq=rs{YmU4RTt8uԃ29ơSwjuME/ߌQGƿӏe͋2߱b][peӌo_~v;z2$;}-n-(iiuFSyaD}}$F;6ώtR2Fvd߱,w.c`,$ij^4׸9܉;u"{pw%*6][֮'=!J >]Yְ4^VK4*oZGwoO.\NZ͌xUZqaiQv}ri{L4Nu6.g.BțBKeن)L·l:')ڎXο\nXmnh(-fj$Og| nSeV>3{q2_/qCWo'"L5JOݓm>t}h8gn6@u@_xs$Ξ).Z7+0_HЃ'y;EY#sؓYB է]O2yNFj%6^$ddFF@r8mیi)Zq)[kmiddfFF] Ի\w9KAť64}C'q:aQKIe"}}9+")e$N6Oiiy;ceKY;m.2_)E>W`7:qkRX \ƌq;&2D(Qbvo+r+u[]lh^[%m$ T1oC2'-$ْ!P&_>]{1+fq CvƗ/[zVIGѫun"qь{|}0ڹ5ǵ[O{_k{d>TrVWGؿsTkiKNοeݼjSebct][FIRkl(R+gɵ[^i֣kWŸg&zKK-Woi|i}/WOiV*~';|y[s6w;[̊\&,̞vKKB2G|5) RaƻpWh[6#joJ[r56ֶRF?Ւo|ųj5D(Cn-.' {5i>}uknR| 5NxWMqqQKo!s1'l}9՛F3޼?ˎ&Etԑ"lcKl/ySc"c I+<#I(Ԍ^ܕOab畴O52mۄt sb-i^v5 7אhے?.aUI#$+;JqH4yzA^y]֞n󶕨r?۝;q9"Z?ȻRҜm_ܭ׾qqcgnC~ԴAPB>B#"B HpN2ma gL줛&EO,ޱoFk^^ݍ&6;ֿC6+Os/z\8gF.GL["][\cړ^z~ĸ8cgh>bեY1KJ LRnc,e$QyLlq}$ݿ%xgqwkS; :gwQQeoh&6o Qi.gqrEFe pVɟ/j8 Ay8v۷3 ]9. c/B*mJ6]4Wzv Md6Ȍbxe 53aK&r+mc8De#ʢ/2 ]蹚f΋J/qNTOv 7Xx;-. n`*d[K|:Mܜɍai'c[z23veV͏_>T0ܻOV^ªU[YRfO%( y `saQqO{ k6JmZ.ͧ)zx) 25J+W%=?{},˳m:2уjx^]y9 sckeҽUr-U+33u/"̒"И og8766G ѥ?[ʷ@2)/ηB=1f{9|ӿԡp%W &l5q-Z3VLg6cSJzIzc/hW$3]}:ysNk3/Y'(02O-`-h'668.)/%/Am7ʄg]xÍ{ 21a|_t.J{+PoL-[Ocn2Nxr>R}ܶ[o2u!ƝmfqC= FDdd}H* nRM5TOMv'm)EwZ f: SlIF=+#{E;K⍮?1=U R׭zݸ_S4R|LYWNuf>X VV4{oQ;o=ev~@''3vi6El~;lZ ?/^?)pαgvדBqdNd~ڗEmdiZmKm9׍-gn?Ί^aGpUOk˙jge8=r,i{r$lsPPi|̩"Bm޶}ҹW&ErG/-IwRG 9ۛtE03li Q|Zn+rܸfu帥as7(GrC>y疷^yթ]uY(ܝ_ݻv[QQRI%DKIpIv9!ceq*Yޒ{vUSHQt2 b_MIے_M?gGjqs]ǽ;WI| x*yگ^^D)Ӱj'ÏDILT{6~n_YL[ffFG=JƆݍńy -^[?4_Y:.yV[ ?V2Ǽ׏Ҽf8K}頄r0 ˳ ,BK*\nhc0RP$̈EKpvjݤܤIv$,c`͹VlS9NR()l @MwkwD)4OvnyQE^Hnu6kwW&DttҽrqwܽY_jŻZz8J敁VJɍJI%/6:teWƗ Ƨpb9k~O~M-􍿕dq?/$у'y;EY#sؓYB 7o+-o~JVK$V'pˌʼMBgxTDlIǵ}*VŹ%.4nظ|ەZ}+Qypɵn[n⫏[pOks#.WnZxfc-ݙTB[X`Y3*nשJFoo"G+uv2Jrε(GU}8mX-Du ^:wWei±RbmzQ'ìҹN+*96`G-8KJ8(tux6n>5>)zk-WZW}xɮa?ki9G5mN7e}DraZlqZm>&G2}|/q62̤djm^U_dz$b-ܖǻs%W=>c. "r 9m.͊",8k~o"iҮ&] yӔUo,ڋ&ڽwn~tvsFq|R_eqJVy7jq?՚K|$>.;ȻyUoz3!Uҙ[! Yq9K,F1!u<9617K7;:4%./˝PRiZ텓ލ֓QMvxx65jVen%Jxpt%7:xM{Yx׷qkv`,YVL'J#S.ѥvyscG1Q5/#Tme;vٖ[IO0ĻG(5!ĥѳÕ[o,8Y]tx,\E 4& IQ' 7ɏNz.jvViai?Ү}49yjk+.,qafJs+E*]+9лĮarh])=O.08Ԉ/,~ȋ1_k=sV i7B[d32og%G#d:=nd_t=H{~dܳCƾƊdpGuʄg<]6_/>hDf >c[RR/N Bn Gt3hsw }J2Mqi=]o,gÖm:&JZp=> Y˂nStn%ǹ?BA;i+7kw_BR|h&u˲^WDL<*~*=`DA7mT'VMu[ݎn{3\Å'{Qbdi 9cFe!,LܹFDf[Ȋ[-ʩQeVfel]v.n SǓ}_J]OrRU꺖DNUQdxJNԕƥrIa'hKjn*vsGݞ j_q̭>TcU}z C&-eĿ~A4Nrml8mB;b㵩upSoVVɋn֞)տY6b]GÓenJUn:y#ǵ80aS.9aN9_LG88}"܅v}M y6[ƭkRj[EoB<,X%U[2κJ~u蕰Gޗ6Jbe%5-I"!i.g؏pۑ.M%5 $(b+ukZJauũn%$DFfj2"I[96wbʎ&qsL,2deY]̉eESF]ț"Qخ%FJ.ۊsʗԿhzkKIbZQtuMNJ_*ߖ5:~FMMM1y{ȍS[☤d%e =kZzWq"<A#2D%ݝ,w_~\ ۦ.Fo*V?ȟĽ: D[kNR`_o({4_k^na/U0qO'u Ԥ^^efzZDf3޺ej_~fs{z\csEMjXv׻+h M9I;Is|SD5&Q1Y jIz K?I}zj~2텫~$6:gwV<,x,\Yܚ^˅}c{v>\׳'ep:䪱:5uL=܏1/b=xO͓j؎XWcrlK?\]/ֵ%nMKHgS s:fʽktcZRuE<^o*KJ*NVg@0 vql`T^vf} %7RM U̓a]<#4 #:a5_qqZw.˒@XߴggFGDndc*\BTMW**kMQsq LM)98{H6vEWqGzuIMLZg'YEus7QeXb2;/V?"Ɵjru ,;y{LRTt{ȾG32bJ…SaR5<:GQHיR`Řq|yTí琯;)JN)ލq1}4oݸ6DX?//B24 ϸcwHtnrY9vZRQySŷ%q& 00`=IF$=*>]jk$2S}Tvs 2KEut'.Õa! ܟuflM-N͙;wk~һÎV`i*kXfeedۅR% [\aq߀>Oc[kImnmSrXvIa4v7"=Z>L(Ȕ+~o39/$ulE:*OR˲Vnpr2iޮ>蟞Ok`u;@؜L~ cj \Ӳ+Uʜ *0_ N`E|}fgiItW|-6^k~UC1TV^fe7`?*{]g5ҭ TwO3 F)voCkqX]+W*N֓aMavr]bnX#j0W1?sw?&˖F8_?҃'y;EY#sؓYB ;y $w[}[mqiRDd]RSiw%.!mIZyYyOʴ)'z;Yh̪M=+[3^ ^8UeBGvV+"z#4X˄pSm(/v_RZn]F4)|gI_W72|iؾֱ2y]Zc/BpqK4֗t*vwvm/E2jyHgeBDtջbkPugeUyX6ʋ2m8Iq$p*iI5WQiwleqks[jty6:!m3D~ 8ES̆~i#uQdz'>/Ҟa֥[Wc©? zI%SaKSe)TyI/FDm-uOl k1+{p5h9&cmOrbDO(Qɥcdnn^ūqS~䗦! _&=z0q> q7‘nMZ#Zfiw>: ͸IP@rK>kWPڍk'왢jZiq/ c dS\gYJڱR3mjzf^.Nܔ7OTXȍfԗoizɮG ~#E\T 2jU ^fDf]-ה:B Że՚nչNVբlh51{!mkڜ'I&4]J杫oAߍW]i.˼MCFMXsZt|SMUI֕U(ok7rD$7]w)e dO^ei.LVj5%NJ;&Q%D:ym^{|;*`Pbz [l,1[;!$A16\I6Vc~ؗ[n#ԝe+g R7E(ŹW QlF"+rV-9.X]U%]G/7ИnsԝW} "l{V2SěUi7eWĔ|n}2y+Ͳ/VW-rXXG^ sgp, Eɖ=lQ&Лjn8f~igГH8/[&-#k'!ߺND%*lKșs)$ɊS2R'Ⱥn,eV6xzN1d/WY w? 8FIz\b-1rg_xӍBfwsTqd(jIFE::7Ts#|ymn.2%g< ꛆuAz]#kVzeOYήo;Wɱ_-ͫuu~\}[i\{q[49~m3iJc8\3y?'-8\Qu`%ݝ,w_~\ ۦ.Fo*V?ȧĿ: Dkukw?u_oD&{4IŖW-o]oTsu5֔&c ȯwuTkSSFL"zܗxVߍٯZ('[ZMg&z~t_Gԧin&bcg#9-Öc95j5﵁ieB>k\i6*^l˯^u3]2lkVZڜm6z :3e-OU|5(^9nZ81g8nW-:R1#w@f_da;c]\Ak̚*mZ2QGL)2K"S2շ[8JBGӵ /:Σ>K$>ƟO1-6Rf72k6kWbe ܌nAE4ix,Tb L-M[-cIɵC!S[KDܤ* *vPҺᓆռ\c_o[p$S'~ktBvԹmp#hһ/gŵ'.kMVV'+!k|Z|fpt967tǻZC_]$(.2KSO4:г,7.uj82MUS\Mul6fmGKԬ6Ms[jjc8MFvnc8(:8 W_drhsRR8j)yI,쥫8a%Nl0qDgkZ3M^oF*R|M_RgH6nfI;ˋPn ֻzmYv) &}evfM6a5N*ź߲wZ"2{2: )XmM}*շkJk*xR)*ίA'{_Sη{Nںj4b3-KQ=%I9_۪/A/rL*snE6Mdcu{9vV""S_B"~E53'"fE̼9ݻ'9Ru~O.pƆXbڥ6,B6ZHU[t\[`u/^ im1f,u/9N+7idipM$\6\Ljg:5־~*ٴ{c=Z^T_1BS j!8dM"%y\iQcLŸҌZTdej՘cUyQ}+˯-2LI+kYϫn:ff53&̉M9JO~ GZƱj<س۵j!+օÎ>{Y(s.kmPoq2iZYvL BFӫ)+$j5 rܱ.e%(3qq#>tiæZJ3N,Jڧfjv2lTc_[N>e)Fa2]}KӃx.{ :^y$iC q4r^kKL -ܺ>ՍgYYVvj\<{9[,o}^~j-W^˛kPj{ w)}^8n;"B%r7#r[ FikdПI4-5%&F}֜)AZm4dTJK>6/m]3tPTqIѪv(R$%on-Ȍ~%T)YN1u]z쪊) m3jLW\JEN2Q)Nĸ}(v\ψ::+/7BנC>mO3Jɧ6"F;.qpm5X]nvWN&;|§%حAeG9JqCĪ" 䦜\dK|ZfYL)_2|ISzd.IRU(ϡ Q}X%܍krNwkn<8bX(E F+1$%$G.}_4+W_M(\.)<_<ȫ 9IS˦NHu8I"p┯k]z>a~܆o-NOxaw }n\r3#7Z{}d/SIBRyR'<3x?ߋ_}?ٌ#LJJֆc,KzӦ4d9o_MڟMVj6on(b9_d9,:tR$H6TǨ*%|[KZ: dFdq;/p.mgJXo+dW]fG݌ׯl/wv #x!C٠nroSTjř;r]2G/$З$-)Zk[q/Kt6g*ڻSUݺt64qj?u')O6_k}WTӋ^Z{+k;MG wp2Rn}F0rFPja*.LC4M?"ךc{ΒYTb4{}@SXS9͓GJDEM6smgGލ*)FEU}ךtu=[6O2r|~06Ȥjڿ%QY&U~œx^?Fuzd7T Jf-U9qxbo2jM= .Wd m6G}:M>9RW$\J>nE*(Pfݻp x2\'mU{Sr5?im1w$5 YZ̛ٮ,JV.ٚݢjpW#%X֙h{lk+.Pӷ&JԹkNJQ\0^dUgfj7)J3t$>owl)m$p(*!M\NMUz<HlIC=ӦٚR]v )vF.\bUJIǕfknN_y27;vq/+!Fjvĭdy9~m2yѬ!9kRcAQCuIyqE5T52XXSsOQ}ҋi6~zuͩͅm^R/ϙ)$܋7TY]N|g@x@ X dN]n&>~3{RGlAe $ӓmՉڪMsܕUiT"'ܙ"c2Ncn'e~tQn5=6k[5.I2؜5ƥ8;'vd3b\R9CVWj:UqSlmN6F); .vboyPln>"Ǟc\~˳B>W%R h!.Mn^n|x+27Q|?l#CqgKZ5|$m-엞uzŸ5Cr5mJ\'%aawܛrmїBzmcy8iw'G/&iyyWys:(QV-Xxb9k~O~M-􍿕dq?/$ԃ'y;EY#sؓYB VmM]Ut˵NNfLvCVdoWZѧCw{hSYu:tl? Rxzܻc%UMw3jyNJniIz$wzqIk]N@k 7mtsjX(Sl@[OC)Fn!?3N GVSu7)k-TR3)v6RKq%$IOiu{hI{7'6۪<6^4'im#,ghak,+\Ɔ3qN;)Z3Z3QXN={_n|,T@g%IQ%Uuze&Lx,ba2C$i/1&9;pVb߫'sZ*Ђ剏nޟj+rI)Kj]=oASsg_KzoaҮ'cyEa#*Z4i.3se!qJ4]§oZ7'-ۚiV}5z 1]e=ԭxNr=<ҋ~~?KqsRu Ixɥ"DE]!.-A%O꘧Y®ub]}W6Gřh!_we z읉}l֫j[N?ykZ*O»K/1g0fz]KE|WGUB@\NpAu˴ej#QUӐʽiTн~d| Vx8 X zZq҄Tt߰B?ەpORt{Jz7&$BV?ƅ&_^qMBG| y+nlUu͚=6* 2TImd,MÃ7H?١0nU3lQ;7" E| ԍWU>lJM>!m-6Т8/gtJqYI_S"Mp=q@r|Oʹ 0ٜä: U) ׹Ei`_BjeЗ*#LuK9f_%/ΜuR..N.jyBiFiǝRjqMҪrY`5oڈQCwzRR/)q *з2kmĔ엷i*;+=E<]۱ǔNM{ ErSFѓvLWHi$Z.[\/YǷ.Eg[24~n56))5TOK(є=52bMN/&l7ښC9i;F?Vp,˭)l{,&@@6x-i$u,֘&J?*۽UeL &e&LeZF:N$uJt'%/&niP3.i7z婻)$uRL/kُl:/&fˇ,x׎9qTyV)^hx6.G;#>mvpo>y4#a{"%gw|Qi[{;en[M q,Tly/gr+V<b[u< $--en3Sk29.JxeqdeNË t}ҟ-[ ~ ~]rӐڋ3֚87.E"!_'5Uzp]Qy 9m i\Rƿs,֔i%v]n2"/sF/9JJTUqQK&m%zwSE'E1ue8|?ciun?I??0_d:?n7Keob?y#>*Φw_,t{W`G;w,^B'iz %)9~iWkYYIE}3|{;!gzFR`wP*Эbn\Ni|LM/Qmqݚ^2qǏ2|u_CWs}5Js92ٌxB| _1h٥+[,ڳ'r͌J@Cpn6>QWeojBj$HQXJY3IDxp6Xei!%\Ե뮲 .ĒI$G菧}:}'٘?oL4j݋UnSݹ7+\])\)NMf-Znx?C撱k6WK̩пhtY~<3cf~WQXβ%¿XP.s{a8%޻bC=s_f̞ꮙZػaj~&B\nv)/ZخK[n %gv] hs~ͦa>hHmUs6V;-32LBz2rqb4Π'wY=q-{'x'?aOl/bw^z^ZPOtZ-Gٷ :ܖ>?)}"Ԍφ[ҚťYU[ihː%2##ٸ5%FQ.$Rît9<qVxv[M5Y>kxsldj)QƱr [i;Ly1E\=QyvKD=9`hWk"?RқY}٥֒Ź5QVDMRзΝv:ic*UR^68d{G.E; SFiv5Vړ⤭ѐ2.麍ǹ(I~6;N+NARr/p$Q齻n&7FA)5d8%`EqFgZ^.\|{o6Lu%v%rj)zerR@]GOf~q2Xl+ #KØ|>4W\>C*zouI'帿KI/8ɿAB`~=6vZνo9w'/O 7n]9|97wCTёiok9cX ѵ2˱nb/?z^^zS}7dzue(75k#KU8`.E#ܒWyg6[cf;]KUYv>n]RzU~i.k%&P- ,^̮Q`l -.,eq̟_9m%ɟ!DYfwFy>$RpSY$ڤ5N&ká{;+۞֏Nżbx[vW!n>>-tMr.ZaZ?cio.~B1ēؗ14Vnu7[g$GUJGsn?$GUksg֔#QOa7R/KʟWKe>.~b;p%5T½Xf"۾U.&ڵ̲s}gu w( Uk_wطIR&ciYʾɳ>/MW{w ph+RW2%$;xz2?5n>) \iꙶn2U}[wVn宛lOT!<}}F't]I=<_Ls*ou>'_|D1M+ZK^'Tۛ7Pi,GVKi#LwԤ=>Xr,yqK^gkTs`S뺕S}6OIr^lܥIܛu DZ|Socwٶkv [)6s"I9&d)^T$MBRiJeO76ݸ)ɷ&-ؗi-6&٘43 ݌lkqfta['YNMmɶåFwrD9ؿ w68{)"O@ۭuq R<5-2JJ򍱻u&=U۸tUI.^^#j;̻iK9mܕ+*VTW"ea!_=rakCW>KJ9.Wp2.G"$2*UtVJmmxĈr)A,҉I׋i-Fd_fI?=?zSk+Nkqc:OIL=on.ˉ5g6շn.֡i9*RMV-"U7\g[QqpCj/JVԸQzc4Sb_`w+n qRr/pd7[?&ꈑ2 WDqG*Zu\r]#nra3u;~׷n=ųإ|q&)Uq){d@ְc2|ͼnLVu/TjT^!i1ڤ;1mzIz,ޢ~_cޛY勪dAiQ95ڕh4mx03gχMJT eғp$u5يD>df+hOaP/ݕ$׸}]oHkR6N[v~qf2biFV`vnMq6rVdWO|޶1/'k#Sێt>gY+.y[ύ4?dua=̹}j)֒RU5>۫WB$3"[?%#7?#xŪ]Qo v:'T[4֍U绰wʃQu3nxZ~n_ӯB%n.Z Uo07 Eʋun| 0<{?/vڇXv0+,1bU)R-խw #1q )?ZS=ҙsKr:*9F#V"ڹu<>ҕ!^S?GR4ve_%.W^YEGUFxnav,mBN7G릚osi^پ!-C߸{k(H \',%6=˩l}Wx$MW0Yj]|UJeZcOwΘ}Ϣ#+>Lze}ftWar+^+cY;7"]%Or+GM`}T9xkmMOO1I4G=Hoy^R] ˩y5 k{`cc/uݫT}zҮJT3?dfz\I(F^ksnCq\G#v =ʔYNnкP $\GE[wTjQuw \&Fh% 9ǖ0p\>$h.UIʝMw]9MUϑR̻"dJ1Ϟg|1N;~D:K{uJiҖs נ˩R6Ҟf]Lq5O˂洜g%(r<7#MڔU>Skn|QܹLհ߾)ۉɳLG{6bŴI:ꖉf.3;M星e߱ɳaJlͲŘ!} x%\ ,J]1›"mCf\KQso~-&TOGTO {j%^ڼOqFp*TΆm+dx u͆w!M%`-{RXr6}'+}/2#}.3/FQTV);s~$>Vi|>ĮԠcKSTy,h(2t Jj.V:@7Gg̉[ƒ(fY4 XCR||}ƷjBTi/2'ل)F1{aRjybԄ='ͪ Ĝlf22y4s0O_W^(_k^KSBUK8_>=El(u6oip5a 2Ň ^D _C=Q_ϼ~m5.fxC7E_IF՞fR[1]r.fsnOdȬ'715S [%^UiZ^հ$qҒRi24Jv\:ityJ4f-_5ھ G˹(\_=ךN5Mq/?? ǟ[d^GFm}@YyWp84_Yi򦫏R/{/~FjRbivYI{~ 9$'W_8@y?t>vFHՊ;톁Žۼ1K?uB 'Z57wjCdtS!{]5ĔմOטv G$jAjߦ6c1hKMv$ˑ__c>4?ww9{@<ٙ$?b_9I? ${ Ɠ _`hg>f65\۷`aGzmL=:5z9}4n r \iZS3%]p.|`npvDbOo"d-*5)O2&UyFi[:Ȍ]xnM%>eQ[s懿JH^v/pu,Eeo:)N\iYʢj.WT/ZJv5{GP͠MW^^KA#SdY@m% /Tu knOݣ~p|~Ww9v[}B]xrǿʗ O"mw4 E){Tn*Ho_95t2[]}$o͸ nxmyER>Nq,g9ɞ>w%ml_7_pce2#/|^ZcoW_b*]L{v{fi|5 )aihH~FIGMĘd>R kQN~=d+^l^L oWVgc^<ѳnEw.TZ`a~/\w4 cGaB.jXZLCJUӸ7ܾVH/z''o_C,}):=ƹenי8o|D}]I3ddJk[[mt˧J%ᕭdH:ZQdGvX&-RiqQҽMu5 ?R2#Ni#s+EuFV=_smƑ 8^_+Jɝꤤ^ I>SFG!goEFOF~Z-l>.Td}[oܿn"~*̝2Sl%ɝ6K왳$;&TUN"AkQԣ3)Im-b8j#EF1^RIz^s+ Á7iER=u&>_Q؏̅DDi:zC*78[_>hdfN_Rv^m6eJYxzUWr.:Qhv!Q8ܣ]ZI$JBp̌ل m~#bYNo5_r+<ߩcػWT-CP^Ȯ\;> w.dʯqd9^RɫQ>wr]Etꑑɧ6g i}CŹoo[u}8̏tiĸq*aFȷ,(1[YlVczu/&u}%-?;/A՝Q,۷ޱyOw5 i{˶mL+Oiҋ(ԖJnfU$^=:x SQNr_ /-Sw^ܻj+ְqN2=azrEq U ǪR:\V}}#'FZufs!)zT~LQK: Ѯ?{oD's~u$/eO&b zR\ /'tNrѿH_6GkGփ'y;EY#sؓYB <.kGcpCij̆ \4!߮qK=4ۻ+%d2c^΄nYƝ`O[fzvΉi^L'(I((FUSpMApռk۞{j`i4gj~&.2:vjZqsF.4$͖Hg4ѩ#04fy闑D]< CRUmY7ؗ=M:1 \HB(_mDYm.~t٬^U}x?}$g9AJNz%4Ge3M.j0|+5S3mk=o~Cbv.)W[Hqⴘ#2$G۫=82~3aۓs9Ec\PbSrZ,&.7̒cH̓*SR!mOvjڴe+JjdIJi>Tj[{kiCH&sc7$.ZE|[dB73;oDP丣p`d,>4̳JʡY8lTRSXZ|yC<9~l-^ھ$ԛq qOmFҟQVc,M:mA*z>?Kl[[5ejvMFXbXBHWxĬYqQaZBSFkl "p>cLW} j. ^n;?[xn{4WE{"Rg)*4mjWu+WnFGy;MgȖg^^GkA%*]7F %Y毳DE g]ع-8qu氈!r q)SA)I#3(z͵v-9(4تҫ.'mApxr*ESbe%i]G}|PGFYC*2qPu0ۊJ$>x߿&eۇ}4߬5KՕ+V3^\'&ЉR,B̲WmfVc"\Rjƴh۳QoKMbMP؛ ץJcN](}Q NT6]z\xqU)ns-e HL}REi'9qrmպm8ی$ZJv'N4Tfekp\u닧_xͻʱzDx:V5zxu_S&ƱpҊSfx'6%܃ȫ҈ۑI)=2&&D2rܔj]S^C/n,2R.Eŧ44zkrLȧQf6YT7ev5 Q䴅-?+󴾨Z;+MBYޓƊ%GR[uuQS28*IK t^dն[pܚ=tWr?s5?fokW0$i*7EUI(=;Ǹ:Rlz. 9&ݢPmގb}e,KN9BbF~+4yuf{ne[ɭO)iua\1!$)-okJG pjUx:SV.GTMJt~ q]ymBjb,'+螗>Kj狣f;Z.]hDQx߲-=ʘs2ܠu y 43Jm)BSR/CSŻ]#><Y_/XsrnI/BM/Bu=m 7WPɍkSmsd0nI%R3q^ȟcbpScdEEs=sTTW,:HT%y'죢I\s=_pnڥt\yťN5j]!غ ^-1EJN檓f7p_3y,3VC4!A1=w+ajV@%R*XQvj-x,bmz#f'Vw1cծŐ̸drk\u-[Sm$뻋n44N1j[8qTRiP'\fޮ˰,?'c~ Vӎ iĒdiQB;#E_+xhGn^k:H+_[^ JI&j3"YJZFT`ݛ% *{A&soȔ' 9=nʰyybm=MN:&В ܃e<~C&.Sɭ.ڥ(|"&#+],M\,O\=ڕE^Yzbs 8GbO{UHvFhdZtVD6|θw!)ːҿQb$.Ԝ\Gm܇:jɼ{ٴ([mn(IQLk.V9߽JYltA<8WoO_Rms_+^eHtSSGvpﳥdfd鷣}ގbs,߻}+w1/&1v\HܱOscN/McURڦ .]eoWd8KJ֥tWKۯ nw.K&rq䶲!+y)ӊQӜJF{0mSz͹&뵃rW µHۃRj|Bz\4m%y=R25a6IRj*# 24thk.L/G1:-%%1W6w[+̺K)t&\dx5̵[lae+;"廗2s*Jy?E ѷbݳ7[DoY/}v4θĘ϶_+6a"RIQMQ >؋7dZSҔeei5(> $^ݨ8.2ۋv^m۹.aYv9PĩoY)y턟jJ<$FsMufwSgz3['ǖ0*hKdJP}uwNgdafi8ٯ阙+y%]8طG.g/Y$];8u.Vޙz9L-e0cd?r.aXov3qɭ?wL2?~c8Vޗ^Nh._V?E@?g[{9@e5c$_gXot_'#yYhO u YB# d71~'_c9Ck3^X~B/7@*)ԗۿ /TmnNZ;cmWœpJi~nl:o5g ?I믝RVSw-гcf<>x? y-L>;u+2+fdMQ]u-87Tܦdo0Q n-mlcY|YZY ӋzG觴=cլ؊yNv-]1nR`TMݘ1| W{wjM-$1͏j+((QȭE@ꉙו裵rLBfBoݟqN7ȳ<֡fY;MQNKŵGg]sd;by6fb_{{Vٿ8YZȍeB*4W+@Wo{3t] `ݏ"FY: ?uWcGhf=-9?s"6gZ^5 'z`t~#_kre!vϮQ`LȒ&ESdWCIy4י>oʞ˩/Iow͹vto6e*.H"͸?YӞvFVqμwoe Rj*S͹ V"ȕArRcqkÐ];/46DIt뱗;STn3ɳ$88'ǻtk[chaXw%(.r,Ptcv\_ %&:0:jht?K/noFY: :g:Oq~ #_krN5$}z>_ǥ'7c?d_L_-ۗ];XjN3͙9;'ٸVo}crRdI8kԩd^z}Erl^g;V2bS~L^@n=Dٶt=O:Ռ܅\gj5~ZO\W"5\ vsඕ왝£B[s*J~c!fHKi?7Ct.'h[T] VEמ1X˅iWM +X7r-JXu,[דm߰>{k*sHofSC΍gx?lFmGHa7tFgn'BܹFb|iʜi$lwS'YT7|lCRp []9ܔW,9q-cfqӚB&Xʬkey}G6w^6ۄ w%IR#DYjs|-ۏN\iJdS hOh3lkLe\K\ϼ|[.Qs|WrNl)^g};]Ce{,ْ*~7e~=w2K̪VfBqݙޝtfYY2xF^mN1]Rj*m'E}z4M?D+9y4Y6saf7' V,Fyvcj/9lv%ıx/2SdV|܁q[GBrOKWUH#$dw1qTNsuŨjk&rMl<+\[br+2 5TB}8V )JH$""".Ј:DG늇( eëY^5dnZ^Y+!$+ o#Qz f.3:_/ n( RS/ʅ}[ dzyڟMY\%,>]{dj^3$fDgHDk9oO._cVlgby){]ǽ8]?kg]KĆ |ׅ(+ʕ_^"O~+ryi׺~?pwsRen֊ueNwG~ّ ȢdٯY/:YeQ6  S\VGّm_!띬{Z+չS36t8Qq/ǗX<!5eϋ%'ԾFBm_4k%N2^ha`>J,%qS^';}By.hݽCwF6m52zLDއcTgP#% = X WOS:|aϮ|l">d2Ri? jjIE\S>.6N[u m֜JVۍ>Eԍ&Fddei:d)'v\_6S7.K"C8-kQG3987V[oBimЖІmR%=~ >OQ_v-$,k,ɤKɣʡO_V͌?N?t^Iv.7kֳ+o*qv.vjtVdlػس7-.x>@kHp1#2`Kd_^Ie SP}ν>2HYt?kughTjv6gK_\Zwׂ=w޹|xquzs*94} {]gxR! ­̙dO/bB2 @~*h O":#ܻBcz1 :~g.<8qk?'VWDP\0h#n :AA ]o@ro[qE2+4g9#"Y2f]Hn&,2r i\krG)Ѧ~Dzgh6nMԬ)IC&ŋѷfN囜:6OacSiusVjD)ПTY$6~)[n%HZOdd<?oYCnؿܷ8pT8-4{ǥfټk*qnS!97kLWJIէ̉DJ:KQ5yFj[V ;]G=?w#s}'&)sIv+qg?$m>;r NS^[50%f)rtvR| _IGVyf7EWN/^q5{e'S"._Tntpu[pQhxwry%ɍ<ǃrI/}πu+X-7ۊο(Z,!9)0Tq+Is%˦_:N4n*?H(Í<ۊ82uIzh'2Bγ)gϿ;ڝsR_Yʽʍr.\Q>3s0(}\ w Byo9MLy' qԲI-FCY>ݗoY,f<zudg~V'_[='Uk;EHRuYz~C[W19lɷr500# ]{n2#6u#멱>6?L3h~Om Ju!`5X-s !0]mcXvM/pS-$%="I7ߺw,TV߉ gˡq.P8:YyMsYͳZuئ2`KC4'u<ׇ|x|MQ>$%h5W*UNe>E^*qDjOl$ti~zGPwE,ޢ~54%z1>-<%ܒl(Z$Տ6v,l59v%&$Ws7JTO6VD C_LS>˱ {uGf +#fGMŽYX\Wl% II*f}4knn-nM!۱AX]9ZRnVBJ甮 i 3+'Tj iiWDO?WHz-?JK)'۫>kR<ҒIԮ,ҵ2}DC?GvEOIb-gjzӮo`aEǤI3 /D:tA c'gcܴۀ0.N5/_caNw7=n哎fM1) y$czκW3)/8jnגZ'\|Z\eG6r^{f}GLP7El}2 e8Fr5v,R󒨭v,a"nP^3g 2M$>Ynd4$"(I!dh>Mvmi@֡s-.ӯ+k^Q3TKg _cFκy8[fSqyӇ#jo,ӵnŷXK#ڟ<6no//̬|"pzZVBI1-I+hiTdZjjZ|=Vz}%wE$SyҮt{'3m^mMƗ=e[ܢw/]*%^X HVn8C6.'?97'>E| K|MI~%ʓZsy*5Uf/l'_-7K6o>B K_̧W"5 _xs$Ξ).Z7+0_Hу'y;EY#sؓYB jFi2RLD}Hd`s%W^^`a[Rk]ƃm+Y9OVHq9)&I}DqֳkC*6C̷*U|JRV<{ w_O֯\nqSӞ:DDNp!Zjz* 3vUME[#QGW"Ƴo/Mr"Sݠq1Mz~uEAH/O${'TSǜVf%xMQI}Oo{nNk_ OO'p//r0LfkbȻhPB1 /TrdH?c W141O5>+~,%ƒU{7?)9:&Φ`4WHBwGOͻOr _kg\2.ORǓ`4|X+R5/9fnYJ͏OZr+#_by KujDLLDLLw>ƩSq*iOl$B[3#4z ] 6zt_ƔIz"coOO#3RSJ0sUVh\; :F _#eJ6}5Yf}[Cj!2Yx#B<>_'_? ϧ_Y KwG|WUu7 ΋܋ 6ٹ24}O=O;l%8YTe:lx֒|@,%֣}塦Ye㮺 hjRȈaNN]my[e[[<҆i /%)"333Eb9y 9S,؆tGquOTt#53R2##c`5G9\۷%qw򡗬OuZ6k`oV^"ʫ:kl9{!|7j\TY]?3GC;L\.[/AI\Z7`ԣ-SkR|.FK<DMhJ(wnڧ뗳邂Fx;X/fʓ\y\x8ʺ(y&Iv1K7=Hxhv㓧|OZ$e ߚ]} ?z}f~.F#)^7>E[95)t{}gՍR-jO[Ƿ87GSz69u%{Ri(Gs8䫎o;xtk ܱgu$NW=#_5-xh>xMԝ h?;}Wһv}{k]3KrѲ;Շ's]|\:״ [`[.Ev 7~Щ9.wCEոM NTLfgi_x̍h?|&«]{iiznn&[|2^u%Þtk^1m6TLJ"l3&>rzL2\[ɒ<5)kQ>fff5`6dzbVۊccF1KI$\ N|8]kS,҆bG ͗"D*Z(U$s[Qca:enHNͦiJrǖ5줦 ?\\#f9\g SQnBr8Ʈ^u>4 fQȮrg<ĮV SRۑb vt󪌋$ʐn:cMǒ|ZksRgͺG}4о0.j9Z=B!.m%sn;β-@#~Mdz觎C,\I3}<Ϊxŝ˄{>}rK&ɣ^'ZޭG>n҆=ܹIdhp\n[kP^0UOMCK.Sџ.g~i?[w?>[jBj[чFyw?ʼj8tԓQaYg +Iu/2Co/nRRE5Mmŷ=۠fmˋo7Nl]ǻkw^vN/l{5+tE[;&ma5ӭJh*pb4kXZsr:2[=Fw֑EnKoXI5ޥC#u{k"QgCI)]ڞuGK旫;#)' |=XZW_L@}?&}'/A#;?͢?ܻDn$φsxko?߮㶗r_ c'oc܀0Nu/:ca&&$ϡtl.W18 W;Մ2* 2ZIMMLuntF|&{"ɬXc;;xN]x4:E~ܬekPQ7X?ű.Y9~p7E3 #Z׸7a ɒl.b/$t"5}u[KN ߂^]rXKmvsӖ?ih_#ruUk>kHʹqܛNroηnmd̬Je卅vdYO}RXϘ:8έKZԣ331.]')ɶmŶ?@:V 3KojըFݫV[n BRaI 'h+7 WMwWS"'iĿG;OAO){!M?@+x?䟹;eF#o|} ҃'y;EY#sؓYB 0kv&=֙Y$)+.";dNͳk/)Dۻ.r[Q_i:l ^ƣ[Av.[TvToW%۫֒Q{s^R }FOir4:DҒXQKIJehm`\ߵPkNv溴A>f$PlpRK?E>>f"9?#\r4h3?Gly_gc%I3"/n yr#?H3">3`w;Tz=&*_)?tØ}.Nxŭ(>bܿ ԥ5 ~}"%ޒ$yc}X1ի<'{=߄r\܏!fX4Gz߅ J$?";>֓#k F ;_;Еz]y$䚺|jK$=+q&DFgZz+ !7sRq 凴a~T_Hz~3 y|K{͝?+Ī5Vl6{ |{K&aoE]CldiE)./Qt O_W9gPp__}~ot qnikkL]r<>bex b9Kvmudk1ӵ C'{\䋓Ǵ:f Rԯ[z̒5S[Tm76,Ni폹\蘾k5!wYcG-ť~<۲em2h5{D(|@q#p@Fb?s&cD̊ SlY]Ֆ3ZCSIdҍlV|-kzI: hƴ|[tΦXӕq2x/V]8p)%%'?/u2ů7-TZ C6ި(3{he){:\K#fDKq1:Z=g2a3lW,G`=_wbO)du>bu!NzUU*õ,8S_ct~J3 jNiftKi2G$Ƣֻ,)d^=Vʹ+=N+ȮICѿQ "ern<^8 ҥ6JC %iER1U\J)GTr\ܛd AӚ ]\ V3&f8q%%6aN6dF([ʦ&w-M"̮ߡ${kCqZ&%^*#F}6 Y~Vm^fuß/.]U?0?_B-V7[JwȿwwK 5VsZۏҒlVdeW)[#z{{T{F|"JC}6A_7DoΑϷ;tsk\"*UU?0}ii8NcM/Z+N5Z?v |VUT"]/ѻ3q1봴kSU*ι>uT==lKlK%'xI'k {Bt==,,7JC)Aø–fw]IMё2e~UcM9v~ȭ!$77͠aXufbLK__)r '6,iֵ4ܕZpF3j'uq_j{RTr4=z 7jYmXdMbg[I;wq(Ҫ8}j?C@W8i~Co? ![[mj7wJ%0c!C k>w*-C$ &m#Nu#NISJ;Z. V_{˳ZkTfռp0f&aq#,NzGa%X?>mJƙ{/Ot5c&. gϧ.ien5Z^{sP!5;e +WJȲk~=[߇qOJ"ڽz";QWk^ viH׵³w"ٺB՛0˷&FRI4>{vo xzeRlld\Θ.tugBa7:!d6y_ZJD<湲n>:+.p?5Nu>nk2da۸ve}Ǟ.݋Ӎ9oG%3N5Gª ,šY6)K~:%4#(t?^VjQw'(݇$~'Kxw6ߴՌdbN^rc88yfUcG ]|y">8?ܱ9֤Fƾ 5JE{9*uo"ŤG&B ~yZ=$%mR_,t=YN'O@vTJ?KVs/+QNdyWČA޳Ȼj]@YōjmcڛSџ.g~h[?>ZBj\&I˸E~ɫꆠژJ4(cj:)d<;`/rvU~qݚb˻\]&OQ bZD;(M(K [Y?:#S(W_Ej\<_?I啃g&jnk)@E3/:_ K]C؞`~<K>od/&z?(uwyS[j@Ig?9Ayru$b'^7y!KQ6jBkO&efvoM.~礚v˵R*It=?X/T=w4}=0hnj SU(RXZserܥ ʔnZc1YNs2g:2]+$gk]kVP3K{^XT{7%<͢>花c]ŗ>,|ߊrW-ֱkƍRM?YUT nJ)8eMܕorJui+u|~g؎r䶦!rD~)ur]#ta4n\6(vיoŒOǔmWslx] +b>ħ_m(5uX/*gvv[dgVڗI=X ǟu^~T{ʹ7Υɴ}5ˊ8mˉ {zl5t.VDe>quUO^siEҎQ2bl,ҟzc`#?UIFڜy_9(tr\qA.MIγ:dbM⭺횽E >=]lz~jv*eLRz&-C&ݦ).I\Ms{̳M#nWra i۞ e] ]KI6n#2Dju}'ʕTE GIz|s,^P0g6g}:n)'#2N7LuOZ+->c#}0i41~n9r0FC 0Zedh8O4i$?~) :p!ɍ)2$mM.G~xe ݞkmdقsإKo[60l_e(bt^f%s+1g0D\e'Y *&6S!3$e?<0n.BP[,nBMaYccZh!_HWM1(& jZI% [r֟r皥3uO_cMzLgJŧjp[RڸɮdL@w3ԹER_]Ҡ[U9nMbr]}vIĭ4SƗ9vy7Vq\).-2kQtt^潅hnHX͸zs(4kQN+$%(BS]n8{Sri]l_t 5(56MXۗcS6l̽}mReӞU9Nێ, YsoW*Kk}X=lfBY%%DKBU%EEJK8p0RU}t}?7UrO.MDbJS5ȯL!t` uuh5$ Rz|>VBJ̥-gJRE3? kCh[)(mŬ̉)B ̥(D^&b{5گugUf4Ț75+ffBõ>eYMIpMsG$e[Ŭmϗb9bqUV}]]{ 퉳O8.[o#q\cؗ9dIiUm~f~&cb P|4;.ߜ]IV&+VYv| vTI5 xM}[7oQ&ڿUx~2ɷUZJO[]4^ۚ6ld)]˃o6D#Pq=+㕙i y# 9~"eV jOe#IDCdJڗf_*ԡ.ָuyu٣h72 1]k/a7)wv^|y.Eզ !ٳ@ō'?Қ6n{(%!ܞؼ=!֢Tt=K>/2۵Ã%n<):ׂ|ߩcT4윛q}2!mk\xVDZUY%"n'Kq犘V^H7u< |6KDɯHy=g LXyw[c&7hhxie)^YsfsYSn՘ForߏsF4 Me(bZ^zgǗS~e vu1_Pb<(Is=7՜/mG T7v_i>it?9*q#.WB9j{ZXi֜ :l^\.EnUUx亽 KF \ۜz)xgu4ٓx5 4uޏN;}bhLa,kc)q#]q G6Opo\RjKעrR荍Z!}"I۶-yZS',zqd* Q P;]x{Әe zY45>מ͛zoVku/ݶ8%mϮ77W[8 Oc*Kޤ/ycz}Ƒ{շa.csܺc IJU֝`C5,65JZwÙE:񴑚}UFkY}W7wTlʶ0S4v_=* ggz/XR̩8bJe>UFs2_`aY Mqo~Iy2]eWj̻7dIMS F4zH^ok?XK89G">HGIXְY**12)f];1}VlWPUc%{f\-H+i//Jn]|>Fh{OKK܌?}/ZL}6-컹.:;:[2]k̓KOtB!#ZOOm?c+Y-̌w>.BZRF~e(LF%*)Q. x >C =h~ZW_L@}% q dd'g^Thگu0"p$w" `: @{vNK$ ewn{ݚu#q+M_got7 _74=]1eAGeV7ymW}Pk欘a"Jme>hvVzӴ|϶s|!n?u9w/Rl}:[ӱo,{OlEE:{%{/kMo. 9qY$؏\8V8rj2rh10p@q6m_]4OXr$oO_}OJÝ q}|t/|?P?tփ@}\:xslhߤm#~Y#ԃ'y;EY#sؓYB ٷaeŶkK:ڔC= FDdd}H:qF$JJJBҤˡC##ϟ/мsw&v/E|e Ř˞0~4U;3-Ǖݝ<9O:CRaylw;WovdkuwC ,*kQJQOцQ6hvŨmUmjvǛiZDzMUҼ8™&5#LݫW$^d-hE#GNhJ^؜,g#(Ըt/7<95<W̚JϤR,Jjn2;iי ݤ˳*SS'-oՑCNmV&hBTQ5y0/7m1EVOI)`zKR|FIusGyݵeee^mh--2!* {MVG{^SSH)l)5I['+.}ܡ>6RtiEgܶ:J2-_8Fܱԥ+Mk$\=m״ѝ^ȓ2N]\"(y&w3˹7۬[~cuURDt60>3S3.k/8VY BiBSOG_l ٭6Y(^e,-+.ܕ{x ^v2%J\j.sulF-+~O:eÜDza2l xR04i lF1è=cf'6tdԔ:E&O!A}B EJط&2,63vPo+Khp/qlf]=IGNR>aA~1 xr?n)= QfΛVykóAՔxUBYܸZc)m?VkR{*`uٳwtſ7/'%Ja_ Rk%*4aok){SS/asIfo߾}գN?۶jGi%ԈNh TXpɃǜf/XIZԧu^M7Z;uJW_[ jt HV\ר)ފ}:_&E2 x>I-p 2ApM*ҙji,;my"iKI4)>'S5k?2jk񷎼עrxz'JK썶geUQjƪN8ċO)ohV|->MKQnȏq3v5E;&$<䈵xO[>uM߂};|vnM5mq7/vv 2iUY1Vz^l֪F?O>ܱ9OMF+1+LXs$yYt##"vqICU/^_(>\x3ӿc>G̛?޹Y}7Pֲ([qÊ@!Iggauccsm.EVSݓ6|J.KqjZ~3~pq4+:nn6lcۊanTa)$m\xfy۱l4Øe9ͯ Kq/:Ig=I(f.yrߏG^J6`y\6~eY'OѲ>|Jҧ;ڦLe +}"(Le2T_:t̙-$J.K2_tK[RϨINsm}O6.>=LHFիQ!J1bIQ%D2?o} 3f+ ;c%K {ɑMf31quOT>j8elE،&nU>d(z(*ֱ~sJ+P̳svgq>7w3YVQ.}I,Krֲ/ifOFtihZLҢ1zgr.؜%jSM3+ciA"+ӝWxY> ]'yNOKE~4PҧZElm. q^Nr5x8BTVnW턑%~Z0xnj& ܯV"un\C[#~eT8cQK߳f#q :kkJZ&j3j|jr'WIQEFq>_7z Nۍ r6ޝbj0+<{3湑<+w|Fι{3̲u)J6?RT,sh}|:fDj5:8]SpQծe=KumCFzq};Uײ.2?^E.knFPB!AŜ@qpYt?Ma/kȑY?u?+J_qq3ç\iuP`xO@ CY_<rOɲ~l>dՃ'y;EY#sؓYB !=xҧ&:c{-f݋qT,%gW) ?'ӡ f,/G$oj$ɩ**J<\]=6W\M/}3Y]t$JsG&Vؽg2K#8  6ǎR{C; ?5Ǵ-&Ua;6CfJ5;. ~-+':;֮A?(˶ /Zns]nVrK-r7@D]DӤ6j4a1SMo!Ē[vBR]qŪ>\ΉAbnwdhl^Qvf5{ h3J؛<֕Ը:-F >-.;wm_Oi5$ .^5g,;knQ)9~.c~eTC)3!|J .];&shaUWxȉ ] ~Y'ĺݮbisy$)pex?. Z%:6J~+D*:Qƫ h-LLdGk+ՊjtԿ), <ק[>#io]Ҭ5zz\\Dyi?̧Uh4v_ ]\|w{TY_Z^L~m 'YYIT$/ַ]Zծjnſu? Jg-ZHݸB]ьR^(|/Z9Ǎ.bcѳha8V|L4JO>0E%&Y.?խӁ7HcދƟyxq)<85{Kكxl;˘2+'n4`Sr°[Nm>%niMC"R[ShRM6fƒeDlS>H// {ѵ=zҬr-;\}޽k@'(if랾 :[c\Wmbʝ|c{UwZ_Jhg #U-/A5%[mJ? }7 s]ȹ PTgrJ໪{8wU]{:_Fа2f?m/]cn i., g|BbG BpUmʆR1aվ:P.0E':R3Nu;Dۚ^ӝ dqaZ=TMܟ  u^Ch[t7%Mn޻\qزaWFj`?GE;YQ\斧u?ƧLkVftQ}_cԳuc`܍l~m.M蜹mץӯVo.vlg],?vƸ./`KpZ{e݉V{,Vc]ztNR^RO BYZ/SyiɯQ?L-z M=ϴ&f[oOӥ%-?rVlU/ qWiV)ՙ9zi)}&S1>jѪgU81p[*l^~MK.gfkoނٗ]:};X^''f /YUK$((Xy],wvVgѓqv\gKpKmAu3Ud}WnVF^]EkoK6-M|[:ct[͙n<s.7z\[XҔYa5 =^ӷm'պ6O6נڞ*l{GIG3jBj\ 7õml Z)cLUDf|LTqiٽhw://*8E*oTjO5hUV>urtzPݽ.pW`cC"XȽevv-u،|ːվk0H x!xuѸ~w7gv?r? ^`H~~*NZXJ4MȢV,*^l6t5aa/y7.+ūqOb=;gv-wU{)Y7)+q>\RlFf"fþ$y7Jئnxj KiQfe3U"sҰu<::]%ucZWaŬ,?vǢUFZ3oG"TrI 2$6'O j4R]n˻zmȯrrB쥛t\|%(.+{0}dz푙;udIyRͺ.m[:3,]vg~ʌ0M핍Ռ{y-%Ȱs쬧R}ZyVj5(k˗.ܕ۲rmm|[|[=leccZ۵jո[n!B)F1I$H,R;@g NGEFDW_L@}&ٟ qc'g^Tگu0"p$w_"`: @{vNK$ и\ ȞPrοEO.YZycTÉQeV骲o2:Y#$WJyp۴y%6nG-Jī{"l7֘gjW-gK˷[d(N-ܔeK9d)qZ8*XLf U7< 㺺#~acSW2oy7K|W DP-Gv yVRi%)/u=?V~k^rmϦ[r]z95ݜ|{;2k/!:صDr-\#mw}{a*s"muj585(k]ײoK#"nɶ)6&l iFixk mXbmYj F[!%$@pC\ hfED5"Fdȯ)ǧgIJit q}|t/|?P?tփ@@;v:>5ƫrq]me&Gj ֫DNބM|j.wsL}cݧwΩN_wZ׸l?j38Btk3zzk"҄cedsuI%ʣVRL 걻ï.0SObN`y(iCooV X͋oέ>tٿ걻u5u>f_N72}wiçFGTKj^ؙrG1m# ɤٳIPiJKMԯ;ǻrە)W 8֏+G{=ӽg=?з=o\ٔrVo"6f((ɪF51+x?䟹;eF#o|} փ'y;EY#sؓYB  GԌ;6Β Sn8Y*˪X2?Av2½.pZe?TNMs h;^zOoj'Xg#* ,cDkv&t=xÝl Qe%+i$n$~XIVjK_4Z}V4vħ6lM3ʬ,A]R~$0s[|÷nr˖\ ]tOzMee(F8xSFR_}~>ƛv^F\i̛\iv2yiX~BීYV˅.Rׄ|"ߩnR3ڏce8܃'\Itp=k̓"X^_Af1G\O2>ZTN4H};.uiaŴ.MӭN$I2GcdUiў(ZBmiq!iQ) B̕I22#!/OLY]c@3|QLLo#Kf7 ޔLn6PgM*Vw/ߓǩ.6$1vt`Zv>· TUy7+54Ɯ{^s*TL6|e$ԕɓJ'>y nK6 y-v«8Jmlv;eީWPMԇdeb:v~ʤ߂ȌZٹV< u"z[jV2UIrgESNy8 ۊ}i+A%XNHʰG^J[qI>+/QBۣD7n>?E8E+[rveO[}z{;m>⹓j\\W*E><|,€Aպm{fܗc D߳SSt8t?"\}*Y"$ul{y15˲ sj1]i*&OOvN5rhY9RV-ߚMմoݱh8qxlJq jxRKVy\VEtV Vw*ۃ^+~jJ;6o^i o`/FoEs<[j]iŻK&wd}|myiw>֠|>.jxuyڹd6v7t?c_֡wgRX}[ӗ7ǿ{ _;O!''õdzٜȷM"Al u'himKd_3k~4jIu}ޱd{ݻ/YTjswx~/Oylg>`9з8F4 #6.M7N -!Ǿl7ѱ+ËںGb69[ϲ5e+ӱjDŔ'G~#ŔñFu$}wY(*J-6\}Y~Ĕ4EEEuMpk򏂠4̻oo/InmlwCSџ.g~i?[jO?j'gҿ]@X V?K`ֻaK ̶~|2/bF&M[iRvNŻPn؛Tr9ATZtNHƷNVp[wYűj7Ter6#qFsJJ2Nu r&wmpwMp9kGȿv68docMO.Ee0Y'}9v~{P;;+)[Mgmmg1VVST63)nέN:5-FjQ\;۲rrm[om-ŷKXXZn7M ||xBݫVv۷[BJ0RbI$)I