Warning: Use of undefined constant id - assumed 'id' (this will throw an Error in a future version of PHP) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 4

Warning: Use of undefined constant id - assumed 'id' (this will throw an Error in a future version of PHP) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 4

Warning: Use of undefined constant dateiname - assumed 'dateiname' (this will throw an Error in a future version of PHP) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 5

Warning: Use of undefined constant id - assumed 'id' (this will throw an Error in a future version of PHP) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 5

Warning: Use of undefined constant beschreibung - assumed 'beschreibung' (this will throw an Error in a future version of PHP) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 9

Warning: Use of undefined constant typ - assumed 'typ' (this will throw an Error in a future version of PHP) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 10

Warning: Use of undefined constant groesse - assumed 'groesse' (this will throw an Error in a future version of PHP) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 10

Warning: Use of undefined constant download_beschreibung - assumed 'download_beschreibung' (this will throw an Error in a future version of PHP) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 11

Warning: Use of undefined constant dateiname - assumed 'dateiname' (this will throw an Error in a future version of PHP) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 12

Warning: Use of undefined constant downloadname - assumed 'downloadname' (this will throw an Error in a future version of PHP) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 13

Warning: Use of undefined constant dateiname - assumed 'dateiname' (this will throw an Error in a future version of PHP) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 118

Warning: preg_match(): Unknown modifier '|' in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 81

Warning: Cannot modify header information - headers already sent by (output started at /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php:4) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 99

Warning: Cannot modify header information - headers already sent by (output started at /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php:4) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 100

Warning: Cannot modify header information - headers already sent by (output started at /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php:4) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 102

Warning: Cannot modify header information - headers already sent by (output started at /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php:4) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 108

Warning: Cannot modify header information - headers already sent by (output started at /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php:4) in /homepages/4/d17155897/htdocs/bodowartke_v4/seiten/download.php on line 110
ExifII*  (12;  iNIKON CORPORATIONNIKON D3S-'-'Ver.1.01oshop CS6 (Windows)2015:07:06 16:51:45BAUERFOTOHARALD BAUER%"'0221 " *2  :52 BJ   1R2Z4zZ4z2014:07:02 21:46:332014:07:02 21:46:33Xy@B  2055160   120.0-300.0 mm f/2.8(HH Adobe_CMAdobed            k" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?Y`s\ʳ]NjG)[^k_IL%o4琫d#enXմv{b 4B ^Bulh"AOWRT@&,t{\ 'CRR8k8 Ԇ,qitU$Ys<'n{Gke1~hHD7-Ht$J:)ziߺ`{Bg㶋/0b 5K?K=oW~@p-st-<Áj N [2fP6t[7i.g^=e)61mw42$4fUmayLײcsI=4 ~V+!Iֈ}oM\5O(djF'c_mh]wѝ!_`}x۶;GsST^ r3[yWWmpl~ڧyccSn /'o;ݦڴ¶zKIykt;D=֦gLݾ@xkRSwcdkXZZf{}osШLzUۉzٷP -;k_k}?WUz?Qnu62۱쬿kyl9aۘ|X\A"Ikg![]W7VZ$i#Wu*qw o0lUK겜@!.߶ֺ}Ol?jϨo[W7ohow;ڗEq}΅ҲȵTװӴhx}/hacr m?1}Kkmui_M]OױneQǪ1öUVkO1C؝NzM޵xEI?Gc~ck`ß$Տԏq6[1ssz-0Z߯h.cF9\3keWw]<>u'WZZ+s7o־ԱYvk};nk,c{b'/w0s_Q=I~.L>>ٷӭ=q}?$wzGʭK ]M9 T_MeEɯnUffUF01NvsEg/#~}uk}P`Uիʷ#>[gU"k;}zn]FfX*a% :YPN9]?qNdY{Yu,Kls ?L4dE Dm쇜̑$s?Kl]DFX]3I,)ִ67 kg}?1o}jվ:@zSl]eMhphLj{,u?Xu^=l.Z-=Zxplj~nS̶M-`78Vlc=G~zMt= =m}^QɪS^uO慍{] KbN8zVEY4<,cO3+ "Ie=}@lcg}GعJl x^Ft {O_7j_YzFf/Pyʥn-f7g}{K󟾸ο5^b^״98Xfvݎvl'ߋU_WUu<јǻ/ X]uW<*wv'ԟP6ps~c6VHcX?psгhv}lҋnFM09wc?R;&qk4?19i{ͮ(и}3P '##":nkiXH,qߡ.eϪz-}^[5sC~FbvCjcM4n D˶wQkYC vZ@:~uB-9{[.QnWn-kv-i4vߢ}?OvOڬ4PM4.q#vcv۾=TͻƲ (8lg>cC._T&1msSJK>sK6Gu4ӒVp !.=zwzv9gt$5tn;]},e.36[āF;3.s1I 1kWW"ey&ׂ;K}ݭKų]9{[:O}_?ޱlՒ^Z.şF8}Sc}p̵ŔZuVcU_gg6RG{4,__,wAĿ)z\]cͣnn[zE"6 Z5n}~޽m\h]]wrUr\Ɔ};ݍoʒ}v;wտZ>Q^-K[MLҼo?V2L}c]vKK>_Y=u WLxWee ]w{.*ǿӬ0:OwD(J@׺7Rk7j̩ )I[=_FGծfFGLqzCAxu<&}ZU}çY]gTCa\FS+:kkz~{8=O,`e2)f52Koiw_籬XUhd16>ܼN_iX.$'ӷ==ޟOc]x-ev8ٴZSǝmof?1_ZȮ]mIk(? n"Ya'8:kt}z(/%͗L]^]m7:e{n6i'E4ߖOSlpcvmu5]ELYL=~Ne88zN87T\/`^mUsc~\-1@eBʽZ7۴:K:mNk3e\.zoB̲h.pn%+o39%!)qve?N;X8÷]=S.[ETݲ[k\۹ڪM_uUgd˙״Z ]U]>ҝpWsŏ=LMݦI.\$߆_(p[ex-uV#r--}w p{}s9Gӷ!8?s~Vn 2)@Yd@OOMA1>e>to.=&5ֱ;WgQ9-ð6WYniguͿqYR:_L-]m$UcXnc1uۗse`rj{wce?@UZ_b +eXkž$#]Xo,ue~ߡW`8]]mk\V1/אlckK\E77g؀5 wԑs.}l/6:55gjr23e}2k?MVzk.d8Z\7>ʟ^l}\/ufa8:t;QeD)Sg.pNvq[@˝35I'_ʌOg#20so}r,C,V~b6fV%ؗVL|LN}07zUŢ]4kCty)HXXG7Er5*>SuO"[^.tx;󘉉o aU=]۽ֶ;hi{õX?`wJn0܋X6Vs2$ndԛ6~_[#zk,[Ensd~NO۵~N;MEG}`2|qiش9n9g__^ zØ~aSzc-4]{[.ﭞbE.q n?kX95X˫s=W) (2cs<ǴLϚ:ftl|+l:nkI,otK: *EOk zyQp˧*[m/I?9HkQ\οVe:މ `0Z~{+WhN_LSo Ym`Ye ;dnNO:vIX'JGȭ4@=gnG\cl"t888~eS͕[@:z6Xs u-@eֲ1ﱿ܌D_3ژ\H0:v=1U1ŢkʲO\=[,}%>=d ͪ] u}[=ߵ{4fp2m]=U8$K=?0:F }a,i 4˞ll#znN 7,}}FZX7Ҳw:.6o@_k.rWKuf߷}U73A"Hu]x?t4EW5Rc2^~?6ͨ}?>mk;۵}d}b쭔5cZ=҆q89V3<{vsyn/_ts驳|OgUGpO`ʰɏDNQXq&;RւOT01ZF^7oXnim)PYYu׌5qƼ\ϻ,U?GZ_P +_U1菡g޲ئ/X'q⮎?Xz5ֹwX]fj>uLޢf-u"TC`E{>}{ t3OU9f^\^i8g? HOTWdgzk׏J?uٴֱwic79m.Akqꓮֆϭ{j Y#"V<~=A~A U_0~d+f;>(m!XpP,~pX\bB.rVߴY~trO%>c  (1 2; 5i"Swingende Notwendigkeit" ist das sechste Programm von Bodo Wartke. Mehr dazu: www.bodowartke.de und www.swingende-notwendigkeit.deHarald BauerReimkultur Musikverlag GbR / Fotograf: Harald Bauer *http://ns.adobe.com/xap/1.0/ Harald Bauer Reimkultur Musikverlag GbR / Fotograf: Harald Bauer Swingende Notwendigkeit (v.l. Anita Hopt, Bodo Wartke, Lucy Flournoy) Querformat "Swingende Notwendigkeit" ist das sechste Programm von Bodo Wartke. Mehr dazu: www.bodowartke.de und www.swingende-notwendigkeit.de Programm: Swingende Notwendigkeit Tour 2015/16 Bodo Wartke & The Capital Dance Orchestra unter der Leitung von David Canisius Backgroundsängerinnen & Tänzerinnen: Anita Hopt & Lucy Flournoy 0, 0 32, 22 64, 56 128, 128 192, 196 255, 255 0, 0 255, 255 0, 0 255, 255 0, 0 255, 255 0, 0 135, 135 200, 204 255, 255 0, 0 255, 255 0, 0 255, 255 0, 0 255, 255 1200/10 3000/10 28/10 28/10 &tPhotoshop 3.08BIM,,8BIM 8BIMH/fflff/ff2Z5-8BIMp8BIM8Z%G@Swingende Notwendigkeit (v.l. Anita Hopt, Bodo Wartke, Lucy Flou!Programm: Swingende Notwendigkeit Tour 2015/16@Bodo Wartke & The Capital Dance Orchestra unter der Leitung von @Backgroundsängerinnen & Tänzerinnen: Anita Hopt & Lucy Flourno720140702<214633P Harald BauerUReimkultur Musikverlag t4Reimkultur Musikverlag GbR / Fotograf: Harald Bauer x"Swingende Notwendigkeit" ist das sechste Programm von Bodo Wartke. Mehr dazu: www.bodowartke.de und www.swingende-notwendigkeit.dezReimkultur Musikkverlag 8BIM8BIM@@8BIM 8BIM 0http://www.bodowartke.de/seiten/index.php?nav=118BIM kȠ Adobe_CMAdobed            k" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?Y`s\ʳ]NjG)[^k_IL%o4琫d#enXմv{b 4B ^Bulh"AOWRT@&,t{\ 'CRR8k8 Ԇ,qitU$Ys<'n{Gke1~hHD7-Ht$J:)ziߺ`{Bg㶋/0b 5K?K=oW~@p-st-<Áj N [2fP6t[7i.g^=e)61mw42$4fUmayLײcsI=4 ~V+!Iֈ}oM\5O(djF'c_mh]wѝ!_`}x۶;GsST^ r3[yWWmpl~ڧyccSn /'o;ݦڴ¶zKIykt;D=֦gLݾ@xkRSwcdkXZZf{}osШLzUۉzٷP -;k_k}?WUz?Qnu62۱쬿kyl9aۘ|X\A"Ikg![]W7VZ$i#Wu*qw o0lUK겜@!.߶ֺ}Ol?jϨo[W7ohow;ڗEq}΅ҲȵTװӴhx}/hacr m?1}Kkmui_M]OױneQǪ1öUVkO1C؝NzM޵xEI?Gc~ck`ß$Տԏq6[1ssz-0Z߯h.cF9\3keWw]<>u'WZZ+s7o־ԱYvk};nk,c{b'/w0s_Q=I~.L>>ٷӭ=q}?$wzGʭK ]M9 T_MeEɯnUffUF01NvsEg/#~}uk}P`Uիʷ#>[gU"k;}zn]FfX*a% :YPN9]?qNdY{Yu,Kls ?L4dE Dm쇜̑$s?Kl]DFX]3I,)ִ67 kg}?1o}jվ:@zSl]eMhphLj{,u?Xu^=l.Z-=Zxplj~nS̶M-`78Vlc=G~zMt= =m}^QɪS^uO慍{] KbN8zVEY4<,cO3+ "Ie=}@lcg}GعJl x^Ft {O_7j_YzFf/Pyʥn-f7g}{K󟾸ο5^b^״98Xfvݎvl'ߋU_WUu<јǻ/ X]uW<*wv'ԟP6ps~c6VHcX?psгhv}lҋnFM09wc?R;&qk4?19i{ͮ(и}3P '##":nkiXH,qߡ.eϪz-}^[5sC~FbvCjcM4n D˶wQkYC vZ@:~uB-9{[.QnWn-kv-i4vߢ}?OvOڬ4PM4.q#vcv۾=TͻƲ (8lg>cC._T&1msSJK>sK6Gu4ӒVp !.=zwzv9gt$5tn;]},e.36[āF;3.s1I 1kWW"ey&ׂ;K}ݭKų]9{[:O}_?ޱlՒ^Z.şF8}Sc}p̵ŔZuVcU_gg6RG{4,__,wAĿ)z\]cͣnn[zE"6 Z5n}~޽m\h]]wrUr\Ɔ};ݍoʒ}v;wտZ>Q^-K[MLҼo?V2L}c]vKK>_Y=u WLxWee ]w{.*ǿӬ0:OwD(J@׺7Rk7j̩ )I[=_FGծfFGLqzCAxu<&}ZU}çY]gTCa\FS+:kkz~{8=O,`e2)f52Koiw_籬XUhd16>ܼN_iX.$'ӷ==ޟOc]x-ev8ٴZSǝmof?1_ZȮ]mIk(? n"Ya'8:kt}z(/%͗L]^]m7:e{n6i'E4ߖOSlpcvmu5]ELYL=~Ne88zN87T\/`^mUsc~\-1@eBʽZ7۴:K:mNk3e\.zoB̲h.pn%+o39%!)qve?N;X8÷]=S.[ETݲ[k\۹ڪM_uUgd˙״Z ]U]>ҝpWsŏ=LMݦI.\$߆_(p[ex-uV#r--}w p{}s9Gӷ!8?s~Vn 2)@Yd@OOMA1>e>to.=&5ֱ;WgQ9-ð6WYniguͿqYR:_L-]m$UcXnc1uۗse`rj{wce?@UZ_b +eXkž$#]Xo,ue~ߡW`8]]mk\V1/אlckK\E77g؀5 wԑs.}l/6:55gjr23e}2k?MVzk.d8Z\7>ʟ^l}\/ufa8:t;QeD)Sg.pNvq[@˝35I'_ʌOg#20so}r,C,V~b6fV%ؗVL|LN}07zUŢ]4kCty)HXXG7Er5*>SuO"[^.tx;󘉉o aU=]۽ֶ;hi{õX?`wJn0܋X6Vs2$ndԛ6~_[#zk,[Ensd~NO۵~N;MEG}`2|qiش9n9g__^ zØ~aSzc-4]{[.ﭞbE.q n?kX95X˫s=W) (2cs<ǴLϚ:ftl|+l:nkI,otK: *EOk zyQp˧*[m/I?9HkQ\οVe:މ `0Z~{+WhN_LSo Ym`Ye ;dnNO:vIX'JGȭ4@=gnG\cl"t888~eS͕[@:z6Xs u-@eֲ1ﱿ܌D_3ژ\H0:v=1U1ŢkʲO\=[,}%>=d ͪ] u}[=ߵ{4fp2m]=U8$K=?0:F }a,i 4˞ll#znN 7,}}FZX7Ҳw:.6o@_k.rWKuf߷}U73A"Hu]x?t4EW5Rc2^~?6ͨ}?>mk;۵}d}b쭔5cZ=҆q89V3<{vsyn/_ts驳|OgUGpO`ʰɏDNQXq&;RւOT01ZF^7oXnim)PYYu׌5qƼ\ϻ,U?GZ_P +_U1菡g޲ئ/X'q⮎?Xz5ֹwX]fj>uLޢf-u"TC`E{>}{ t3OU9f^\^i8g? HOTWdgzk׏J?uٴֱwic79m.Akqꓮֆϭ{j Y#"V<~=A~A U_0~d+f;>(m!XpP,~pX\bB.rVߴY~trO%>c8BIM 8BIM8BIM8BIM 5HBF_9387_Bodo-und-Taenzerinnen-live_quer_deko-highres nullboundsObjcRct1Top longLeftlongBtomlongRghtlong slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlongRghtlong urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM8BIM!UAdobe PhotoshopAdobe Photoshop CS68BIM%M[_6Y~)T8BIM&?8BIM( ?8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTprintProofSetupObjcProof-Einstellung proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM' ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$7"PGoωgmr o 6tKeG}GhP`aԩk{j~WӪO>BLh hG (7<c;۸wtt}N5WYt, t ^fݸq0@":uR$힬}ʄd:xc 唹'p#n5'S΁_ʹ>nXPb R|XѻQS"E((aX#oWE?$e ǵǘﴺ[?ARu vOS(?A 5okv"=|^$GbAxm)R?߰{gҼRanņ[;.~|x<9e!X§]qdkah^qk^ڐ 8v|ל؄*G@?M,D*ݸb~>$yl47$g W* ){doT&"K$}ZӶ(׎ʱ$FS}8ݧ}4s}8Vm@HѶkڶsPE_y8϶  gd jtMWb 4'Km>׉ϭ,JylY}I:cx܋,(c mı76p5Q~,1Þ}liQtkAsyە54LJm#Ml}"!I[keo T̀kQcoi21=th1c ]nZ[Qq}=߉zlnZƫLUx4!wrڐߺaJSv$}h-['hzPYuY%=a4 yjQjt1(IR&?ky\'B+EV矝<[~Q3SNd栘)b1mݶ7"v'Oݞ}t~ b9م N FV6;l >19sEySF1 ̓J;8%)W;E${G&Pp7*^'撀z9Eh$ÞMD3!oji GÙa/@1pA}}#y@էϜ)0+r@7>wsxdR—Qw<ē_UIYsP$'[I,cu&jR"At:vq[i'Uw>!$ Kx{7VRb@8AK`+oEZ`GSXunZ>n/\`ē~%M)#[\v(F> L Ewm$_v_x[]|E$6ﴁ{vǍ1i[ SUZV00*@s0Q}x%;+Pҳ:B] 6!{s*) _ <׀mzWk#]@:/ÿ$BH-$ <UgrT6fV۰_a=ye#P[_B@כWǣcmmB69V`| P@Ǐ1:Tv _p6 vJ*ebvkUuuپv`}<by- ]JAs̀+pTw Ʀzη5$FָX$6}I'}Tm4#ҒUPu"$wwHX Fv>߈ k<Ӣ'NdR=~gA"Fھf{ύ{~<ʗ$*ňiVĂm <.8!E"; q?NnN'}%,l;.u|j/$y{n<7{ Β(; uoT#y򫈨'u25f=6w7;oJtRǢWG ] `{j>.Y}kX2M>OU79)1 Y~߻`bA'8b*W?RC1a؛bmacq-$PN5e'{oR[ cqqmt>ߏcO5xn5 GǾII'PpT*T |;q(cqĪ3 =3Z.@.&TMN7A߿q"V<1W*#&"iiޅZ"YF{|;q! QR4LrZ_oc 6 릾-k`o6fooߝ(EYX ^ 6$9DCA͏-8cUf`9SrAqaof,X OJNP>:sѢ}~sd5dX|p_HPn@:VS_] 'P50@QneƖ_8mSn͕rD1=癃BHG:O9V\XI|VKC۱sB6[{B{#ߛ^Æb;oqO94 y&v`ShnfJd)q|O~z4!:xv-poÆB& co}G]omG"kqm>'$3/nnI$OMkiMojp-؛C_Lp4J+mx[Ó6T(bֽ?dV6nB`GoaAځI۩[#$5m.e`:Ic^ڃm 8Dkavܛ{ ri"e+bM'ʀF .HBq{M=Upr*;J%M[Aoߜmqysq̬b]u#AǞxW#ז O`>lMoݿk}$9<{9T*l %GMG۝ce76׵oG3V=6kB+B,nŮ@;u=yb< Ÿ-`TjT}9Ӕ >˛NßƶMu*,\/R>S$B3pu$_LjӖf$i>֤%rqV8LQGrHQ4̠,GOUvV{8H݂t[-+~6D@Eɳ{[SÍϝldJ= |m9-` 5>XH md ̑ҝdO1]Vz`Meq,&#eacuqo< \WF}?g| ~~#3[;+(U1;ImsU66^ӎ5 x {=C6pG8ץa# oHF ka}?O;kkoNq}e|?+'#*"l W xx~>?$qUHBMXs[_nܴ1Ydf {i>5kS۽6G<'ƞ^)ko۞UpM`pn 6n,v.oݿAYKB"3X,EΧ3KcQ=a^pfV&[s&v?=+R'p48<@evLb?{~'MoEiGV&$-J苷\~\ΥQ8'B.<vݵT²%:k߾;pD>I:_ǿ618NWDOĀ<;˷$Ejv66ǍI' io8%49ݔʥ$ [h:;h}Ԕ6ܟhpk$2>xݿ>z(–Ѓoy[180y@٩_*AvLJUmDqp^ZQ9.Co}G44RYbVfar/k9p6?_oy$Ѫaq:؏eF-( U7ß}z2 ď&I#[ o5 SOk413;wj5=}'^Aw>qS2A5gAuR-Nq9= -=Ʒ sϲlv̉IR =睁?}<o9#mx€q/aNvDnʲ[6+8VBIBAIȶ} 1FkQT|/oǦ}<\6u>=`oC isJv?Qt H׿r`# Pݴ#kj+ QV܎y^9 Bucm<VV{]H\^^cʭv!jwdTelok\#hʵO6y"w$_sғ1eFmE=ˏk{C@x{Y^Ѹm_]-s}51yU6Ve}ʩkn?O?dp4b>\w"ǖHTV61 j.{}ߚV;1$m@G)M7Ʋ\e7[ýZ\߾4 ӟnW&۷k\d;Κ^9] c^ְmU!&͡~cp.v{M` [5{-̝lm`.6l<eǃ N7>Ý.OSAoG< Ǿf㯎2$xyX=5:m>C\ oVA$mZvb=>X":ެZnkݖ׽>:G"ۙ{}ͥ @߻poM/7mnExL y!Q tq;kh>UXn+s7ۜ]vܑ}m{{ h=ՙ8Ю)6vyY,;|~ I#)[XsM@\,@>7N79;*3He-k&UNqP^PA71^ұMƲʩvW̫:u]em|m9\ƹLcI{ZG"Jxш#[qB}3_X'x'Kw r)Yy?ݶW-f"/sUXÍ|G\,=qUymse }>>dy=.o8tbX6kq2/5 |OPpƶ];ױ]?>`0@i, ]E:dljr p UjM|2iƳ4( [>sCHV pGÕ¬ $pՙ-|y'ڎ\Xܓ{?6 )1PK"7 m󊨒R[ۯΑx dW9\b,BjNno3 `!4$h>8ő`ǰBB_i'`@/ω:+"$_[sXќJ`4ǒQ/öیIN# e=?oc܋gۏ# b ԰rm} |MOs6=BEvS~ӴV]cZM=Ӳ}K{]c֪qԅЪĠkw#ɉ Drm`O8L+%n.voqRA`>8{Ҫ+Y Ӿ{=fG>mx݅) o`v B抸բLMvCkAۘ(m m mZ+P,h.?8YBqcNB~>ݹ~45c1»B e=DzmUI-ld)*.t {kc{\[:k]nώJ &-M;^p՘-̊_B#Jkm>:pc}d&%x- yʮEml,E<,EP@k>gc4"m$c;}Yi+䀄Ta=r:h=:(O8Qt2,(0&|ŀ ح$= 7D6C|Gm45B.wM~gEܫrv4p+Tn&IsȞZ)t`}{}g^lVɯO@.r~9 DaM{,;&YͲxs}÷͊5pi眶Nc˫_srf?ub`R267 .}>?q#yi+ā6{[vu-۰炤~R{1ߵikཆ6H\cg!Xims>7恍Ȯm Hbfýp~//[6 n7'^-*5w셶RZ3\2R];G<͵$Xo#<zcwg,Wߣnd&2;h.Aʓ\Do&Mpws@5秢y+'|9ݥ džjEv1`lK7k,+r5j|HeښX]\ \qvY=˛KXwSQmma>U)$RskoNvt`~zxU;k-FqQѨ[!:=?婸B ̌}ݾ ja2(*<.t"sWغ ><MZ+*AWcx[2X:Hiɬ;>̀A$woΤ h[M灜kD˰ȳ(k}6yA's\AO-ַ\0FSn-qˁVkR?`;F2}N#yo?=vzUɽ1ۡ:X[v>׷:vpʪ j{.?.P@uh~J`ksoooo<Ğk7+ke}|فYE 4`wQhMic`<OmБϾy諌MB}YOa{S`<9  7[W\bX[w|02)VMu˿-92*d{ĀIw°KkO{T_Oy'PX\ 7i灪 1XcYbUݣ>鷏yfZnpb)ΪQR#ʞx{("7qǻnݭ߆hØʯOfIcaJ8bk0Y[] ;q~ykTTt:kGm@Նo8Gr$%c*r6zU <@5M bmcqs9Yn7}NꞔVf@+G6אʦ6R \Gqю4 v]֤0!nT|y܍EeC.E}|z6f&X0ZM>j5P|o?FppA]H M8Xx_Ra+Z瘩B YISe7O'w:~r}nfI`.mp=MM]{r_<;9]f)T"UMmj{}=w?-9l& W@HPuak_8Z9)k׎"}/JxaJ&+&tfBT9+?GoNN~ӌi(' n nN&o8?k+ z!F(U[e _"ݻ\ԝt:>zirj3ww{1;;tPŖR6 km7wqif$^7Dצ#oP$}'p }HvtgۼE mI$VUh 66Sl6Reᲂӎ #+a ;G6XY j.{*1=tgmlJTx6w>w#읶^ۊA5φ4tjEύFNOpXT+,Txh,,FŇmU=-ٻ;~l*U[)@g{F؋{9coor q}#%QUA@ZEɭI#G8;[dDyii`*(ͽE Pۯ}SJ)Vb O.4<}#FhN*ӎiK<b=xQd8M}lU>{wRBH'Of烄DŽd+1]Fcs7n?c?з{S 4U<tS,aѽbUnx%|ί!G ̟iՊÏ \!V9!=cX O5p>ts $Hϟ1䩙vtu:{qjOn]58eM}>w"8mXum`)D@W Y(gALj$?I:E'@)"x$]gI>f7ٴxh;}C$?V,P+81s U$Bۺ_7sTXLT@tɩIJ o6={W#^-˜N[H~5#@_Ýoʕ N>_zJY_c%m<8pxSe:@?:ʵRGvܹZA͇nǵI>_=B6yz~ΌηFKGko߭sBn7UՆsY)F.B%}6x5!XSiISftW$I`?_~I+#4sm5Y =)@yiKa#~_tAӝ1pg {z+H k{2}|4rjHNb[o۬}||/&uqЏǛ)~U¤P΅9 5=7:sro[#QIR.:;!\L J6o8S͂³M,)\w'Į[&/{p1Gc_./Zb+ Ԁi9Tl#p`c4fãkC@tr_]a0aX pBip$> !7ozcfݽȰ2 Qm\t'NggGmF1v۴>˘v Vx{~&V4a8YJd ^rM>MvQ{!ÞE)j8yPXXEԠ.`}M4QLs)kPӣ^v}2m㵍Q"[Ac[v0T1VM=Ԉ ;)i%o_=f;󩥭uM@ kl}, `lhVϤ=Vjs5&Eq_GGLRY`.-#qY=@tu8PԌ8m=4T1fb4:{*zqKNҕ ċO—\. LRUMT \voD1T1â홏/A$)<:3;oo TLopg-}oroMIRc0=}"8!J`gSy:~^-=x G\8޲c,]c$R/Bd'c?v|9Ո6Q|b2H'}/oՇ|ps((c8c\i+ 1~|Wx"*X2_O$[|1TpՖҝ@]*6Gj U [ rd-[x؁zЄDQBˠ*Y69сK㦿F`8J>OZYO"JmEǜ٤bkx_qqG=\V>UƶZSDySp$VvܒNuSoga6rzu2O>ɵM}2\dkT-̅c;k or|,9gW8~4jl/m|9Iꀛ Ā{{9c =U(Ӻ;HIR{[s6Ym`ok7aѿ4 lQS,7'vw m䨈q?Ǎ62ikk0ipmKӌ(VA@.ZZ\}_O0]"JF<{)˝@Qqۙ`ftV ^N22+qp%A%-KrA"V)Q5x5)`;=o JǷ֤}Otcyq] .5ljÙBgPJ驾k;9VXY<57|yO˫u&׷($ MwSb^${tS[X(I[o4} 1[}n s`"#&^Ic1w]N{Zڭ6IUj+ r)HÞk]`eL{cMxPlic+_uDžgi9)ÎʏC>@KsGccar0[rcYScu祒B$o#_HyqXѕ%K/;7\h 5.)/u~@Y@A:VXǴ"ǽsm ܋_͜vקi[ӾI"Y$  =߫6zs´0]wϘP6$jFMrAcXَPh~7 YfݠO=$MynڛRoa}5yUHTiTs-p{ G*V8VA$>jtn} ,pTXn_M`Yf]{GcnrR"]F+yM$cl|=reGwI>{{(>&0Ɖ-y1EA7^pe@{][s4c4烈FʩWa<56[^:O3I*I>}}m&f+q5М;]t + |.TxX\p8qYW0P=o%QfSڶc?lea-kdMxvХVq$SD[w1ȚR)[}4x~R jAp ud(m맅,5׍¬+Y{~ऀbFy=^dm)ڠJo?LԀǖ[묥mh7ko٧9ĕwGVr5#ۿ{w{g>lkXu$ O:$.۷6""hYJ,ko|yXJSVRFUVج:euUt60{}</#ݧ/*eq,o{:H d;obm{Zx_rGd;@b۹#_oVb{\lyVX;ZK?oi3QޱK>x9W׾=`SpzYjF?F˲Bֵxq鍜Zqbp`\Ò]=~2Oke&)6ZăI+ys.:; ԐkQ8Vjz3=9Xcb Icoǖ ;9窶"nP7A QȂn6W?@Ƌ^Tnlsʼn1R0Qذ? Ad$E#>n2m!B\:H#e1Mcxm|P)}(<]>|}cP?d4(Onv(*#ɝ)=w$ 'JRzw[{X_QK$F`Uao_R1ZºFVOOs{t"";9Ьܬ,v׷}?>l9֊"Es ּ̱j^#U:_.*$9[F6pLwn[|;߽xWRщ,X ']Oo쪇Aoq` ȭKXNgU-kǰ>hfEkv$SXβ \as[#[hmX6Qc0:mo1,>q0k@\xos4nUw$cNMas(aZ[vele'aU2DԴ-\ _Ac\󊓴cl֦qlXucpO]/z"z1}X~>m(fmuZ%0 ӭ 5#ul@?h}vw< .}yF޾p]AQ剪²o攖$bogPұ-#S쾜d%[U'IۘJF xCovEl \ݶ9TՁP{ ߞUXnRGk{^Xl$'pI*~~'x_/ц5DO ,7F"ݹ@67Qc7|yjDW:Zi`Hhb#0tssJ}jGޛ[hvt +EpC~mΞoOM\eh摑F[q_o& 86юZWb6rjĄS N^46ǰ{xU; R,ʤ [_M,|=*oٷ G~+Kޥ {ۜϙ,t]mПgs9:w[&f8p8SXq`ÂC57,6Ӡ"d*̤ t7UIA #\lHeؒ{h ݹaRk*P):|>Stxl# $-ssnsECt[CnjpJ% WS"NAL f ;xiW묉3G"r[;r7X{H6*}f)p7[ v8Fy{oko_\U"bPF*t -vؑ>?Xj'βFhjEỏ#+"ky"AXZk d ·m`++nV76JKP ^㻏LȪEealV5%ůc~I%\@"I #ex5(w\vth7'f:h7*\kPN`mfs!._9AZep*kp>ltBY/>5&(%lw:wx[;Rfm|>l _.z~U\gC値1 .؋{~KZDV4L󲮕eGtgb(.m+!/l>ngg=umX<܏;yr;nC7DkVX Î|{-@#pr{x__rOeiGfcW>ƃ̛E!orn7: H{G?perT%{^pE%F k[Nx]K9獆]?oGEg%h}张mRMk_#0jl$aÝB&"6 '@5#ONiI'L8VieS-Smwxǜ?oa׾dz <ҰpѨۨk_h<ǺH@EŁ'kՈUcLcXK$m-~ǝ$~xrфӀ5YF6mi+5:ۖ{gQyfّMCm6-sgaar /Id_)E<.~?y)d,DyT}wR1ΚVaBV,+S5KGm"{s k\{w/S%^؄S(w;Kvz|*Ux o;bŶnh5y)tew 4[[}vjӅSdv:} ؟yA^و+!E5t$|yb[hsy5٧P}; pt ȋmrcvV E?Qvs'X @5m mknT5>ȴQ yNNn}XZ%ECak ߷\3T.6TK8^HӸ?G8t{URߕ8 .IO1%.FS>g{sC.@}ϻ+i<?N8qjVTveԅKM} \+IurZ"3)caO}|؍0Q!p l|kk8cSNUr14E~"uQie;Z<oMH+b|`iI]5=+ா"[xqemK`xЍj{xsb4_e(lOٿ45*Q|`" ȃ&֓ibYIkoxA~\!bʿˡ?'N5{.wiT" 2%QTYAmRVP9;Zyzv= \h/-]: 7#dz8THb{h[jtA` 0F醆,{ksdbq6{\WOw:7NV_4,[ݪX=")+.٥yWճIc+bF?McĔ# ŮEŭoz+RFyTnA@Mu_q9{@)o5` : dfYq 1{1QbOߜڷ D'wߕ1V+_@»*d_-\WN&Vܞ!;cT~j/s˕i)qtS=rMSZ-"ۨ /kXRៗʪ ύqzh2AGV Ө"+\۷0H Îj?X=X)zYt&{鯺?=8!Rd^D NRq'ʛegnؕu![[ik cf=VZ¶8Y):v2km{{ۛ~vcM.鰸@ 5d[)۷`=.U]N&jXG@v\wS}ğN7O\'ivj9RӪ=m^d3)*T)qhB?u+jwHb˩kkn"8sneXv%i^/ZI~'%{4iS"Ls)@5G~>=܏ mwAh+R݂ܭ丘~wm4{<|7"7I-߶~_22]ЏqnV%I:mv@W8W5 ,ϴ_Ǟ_()bo|-Gp;T7:l~qhSe:g_禩;gy  I mSCs:vuVʈ¸-Os›jIHYOO,K!E߾NV£ddox~+HDَx*%B<߰s2J@uQvyHӅxXb$aJO/B{ӧgs_yom-k;,B7_Cʬ+F%lfv{9{hg {?= XI{4Gs*H[CvU+::*z'ݍ{ږV]ߗ]3q@Nۇ9LKvrmxp34>H_oGy6];s}{|8DvDfĂ_Owo2? Pl# oP*>Cf 8yAm{>×UZkl/mFO:*<G~oƶp"Fs\.=* GoiΩ\)Fmu^DKY qs O" qo|y襍p_CI|댑rp;ml]v_yT(7 F.=M|/͓?} hHݸ;ߝ_̵0ek )XRچ$bT[K/=!I3 F_Ӆ\q%]bqp;xns>ǽr/o,I;XA5l5gH碮|;xju/ ŭo}1*\C {ÿuĖ Eq譓"nwwiws]U +>*Fzkx* {{sR 76>߇*M8k!emsc s͸'ċid{ ~C2G>Y^72mMx[2Aeu6omd9[$luG>p\&{Xx=WP4N)؇ :s`IdOڿݧ5?:qV`o>^yEQ [5gi2HlUHQrV=F4aV?mF5:]ݖ *  s_ƽ\⺯amϳ9Hس~zH 6W"U6`=Ҥkroogos ObI'Nc[$Rԃ#P7:||-nxiP%w( 7m47:[Ğr#\ڑm;Gn{mnA+9 1erWcfk9SYMJ rH$~>_=3$)ok} VM#I{-ӱ#Ꮷ>RjL"`tl5oob!w77~^?"~UG. -b46;$[HְEI|+مb-۝lZ)R;~=ߞ<KHKi#C1 n7a`Tm>9ZTL&efrPh47?ʑ˯U&k,*B[i4n h/b>>"8yt|^]X[{(A}t8*DaX|?0o]y<f[xG _sבֿ0,L笅X# -̈#6@n p甙bq. ܠ{|F,#x v.)zed q=buoI =2H͵?)U  w?tMK(D)|m~/G][9S!{5įˌkk4}*T2Mη]{"o}͚yyF-mbE׷ : EӱO$W+#r yFۧo%{{i~ܸƪ"z+ .q=[R{HKGpiѲ-&ɸNЋ~|.Bc|=[@^8}HFwn?>rHsww-Hzׂd8.ňu'pǶѻE;5fvB {moiyX[Pm)q9S0S0a+?wE=Ɲrnˡ:Z71ϲ*cJxFX+4 P>ӷg7mҕ&A睔32l!<,7 }k`}|GnXMÐQq,6[Il=Tn={U-cpt4կ+k{(oTmdM͊;[;Xt2K ]QxUi+)beV]Dkq{[A[M1v ht fyT:1*+  <㉐l\ En^(@lšazr}ѯ~'pБnu&}xAI,R-SjmbAmotԄs|?SI `yRHjݚ0ň|-_Hw =u$$gW0*G#T ^ċ5H^VeŬ;sO<.8#OѰ`ZTwְ=|~Jcd!6}qqu;)0>bY$g `ǽmH qw0.sd{yѵꀒh>M m[-C8qK zV/r  yJ[*NnQJ1ēJRְ$ %HiݨG1HUQ 7>')lI=MF͜*T,v۹ m2o$$kl~Ut;}]w5j*.J/C@`r~<).Af)@}xSU%i< jZݻۘt,9+g<=:D${,wې!ۥ:8tDŽÅ x%CW;|Ùb \q"mk3B5x,aGKn'65?O:Z"G?~5sG'rKiqmNlQ}_U睵ب`N- }Hs.[+Ƭ$ǟƣ6(]M+{}MkW=w?)Dq*FktN'o>AQh [O`'q!$Sj~ω(D|#YT@ w߾{yŖ\Dy W]Glbb˸wԋ~r\}w#?_<M0b}yS#$xmdS-+0OoLj\`X$[AkxrvPhHLa_ThzN`g0d_ѭ}0i,A%ՅњA#sXi{s.GO+"쵤Ls;b'D@;TUJ^6{}t*' a8q+6(%MMDX"/uNJm}i#AzMEYK`W* \릃o"xȢv( WG'V5C%L|uX-rwi){k<:j<~}yL*#Vu95τ%ZVA si/!*<}J1<)eHD墣m}E_Q[>9 .ɨS 6hiI sAe:# S="7# { !cM=wG1'}yc_n~g mgiьC8 ܝ-' 2$Ɠ)!ЩS`/vkܝ~yER".tS"=駏q瞊x>5)deI1B3rw {[Amw|I*x`N10ʃ h|T_V_'P;Z~WLc,RT_BTm@"W& b_,)7Qt@Ok۽.7癦 c#J |#I.\kPSTT Hw7뭮G~>v-z9TY"A"4Bt$vQ0mm`/o.'JhfE,xiɅv܋[[Ϻ&ݛ,hoqm}TLH.I=4"`CHHlCX әRĐ׹ 9J8ϲ, 5S}Gߒ1;l-N{-'{0eI¬vDfo~<xnoɫMGIiXaÎ{X{'@j~pa=jUD kÑ,PTۏ nbA!YB77s o{sjreo;U؃ߵZVy$Xa{D} hIГpÿo?W4ca"$'Hɪ*{Jo{?>tGn# 3ezbqa{3US#: h/cso۞#h5bF,;h V#O.yR2Ŭo_i#Zфt,,M9+{k&Fk{vK6`G4`lWotmqwԟ1TW0-1ܟRn/AӞZǶN,JX&@t`A؝-ߕJ *e *u'ۥܒ E2ccӓZ' !)9Η|mnp}O{\.|yqT8ڦ{|=:ijI۩:O~x O<+q\LU +^yy..~ۚ00V*[_ ;\}rdX= ؛ΣϭUI\;7b6A<>qm%#<O{`\m}ys26 r \!c),>y;6+a-+/7E]_Qv۽ӛPÓWXUi {tCAr"DWM[r=_GToo#ϞpHTŴ70Q { k߹ӿyէʌ.ms},owOZ -apx:HPC\j )SLs_Ge'{:`;|XKn;ʝ+AkKm[\"K kXoۿs3?(l==i967>qqks_o\\d#]@Ü{v#p ~=1ஆinr)'m:{Tyʫkmtb|@R,L {CboHE\\={yUwFq {|9+}ipU@6$䲣0m]H:Xpb1-G>#+vN×0R8un-`DR IQV|0v _NHxlף[@yw[A~ۆ_yK+%IU*cYkh[1FXns` LsEebXua{rkn#e[ .;s`8>U91ƃtט;GԏgV8c[xWl.6iqoyg>Z\ܒsLb})<*`-;oogǝJ΋7t۰aҼMq,Lڷ𹿈'Cl,6ӾOϛGV͕UEݰjyȵ:E5EXUԑh 7 ϯ1[&' h:v$@5b#m͠:sbM3kk] (kǮl0\,=溒mf~3L;Qj΁d"\ n~ 9>Eo}dE.@c oz݂ /ߜM|G}92o0(RT/okp߶S((#RyHo<+q碻ܨ c,~XsY,- {C{·" B'I+CMI1v|:^s]J>7$)-k`iGЯ2\ߚ&%Q#6>c8^mu q)W瞚3mdC\pVA`N]?1(ão1QUͺTxϝA92*SKoMrRP¬\b>=kq9c½ti_֬BWxiI1PO8.byN[S~8GO`q5 ggl2&k5$fbA?}LJI1V}Gc{[A.=5_|&}gS-*<1xͨ$Tbne>fAA8iC@C*g8Mo{XMI А[A$8>_HC%ᅙhq!p˺^Ƿ{ߜD\D[o`G1y0 TڞWh<9H3btb,m:Gru캏-aǒzkE'B%P\vnϳ^&-6Yv;R9|&@2CYc m-R\ZHЋOnRNt1ϖȦNdkyt݁xӿ;§o%g@/4'r bװn+b;5k*6?joe]'UēeTCӺXӓTwt ~\_6G3E0@7Ћ|?Üd(&y+B;~JXuڣ\۶HKmxk=kR9ʲ:Ͼ{^'=5+m$`@5_W\T***1YKQ}^^}\YUlH$xr5E ⏸%A7n;XxsGmk\vYK_H:r pH6I( /m/( Mw|9<+r+FLH k13jAp߾Pl5,#]2=mqu!"ks2ݸX >1;kj<\T*ck\~Fۆm[Gs.U<ӣFrK`X<ȡ(q'TS`m ˴y;7KnX pt9615ab1E{@ ~j sw=Ea,CHX0oU*@iemj;{{[]yɢRA A=~xyZ#ebFembt>;nqu(mG}zty* J *}demۚzU8W5_;ks g_vSUT~Z{Ĉă( ;>֪ cYUE,1. >mo Cs0sr6RA+KkFI6WR-<Ԏ5og\+h¬2mEb.t;HM)L{M7ԟW`G/cU2$ia?5Q.Zb S!ĝ{ByJ 5m{syeMX@rs]X#i2exWmLgW8QN5XF?yJsÅSGH箻G7[ ޴/q \%ݬosaƴ]I?pY#ɹܢaUEf*bk;v~8B$E7+kyI5iL*5%I"#p1q2(*>&xޡ]S G>>ͩ(0ډlB6>U1i/rRP18'UK; pO3k&ywk{HG%@Uw:}~t"})$Jԫ+%6cD.6H 5rQspCy_vZJ*"I^xX&9ʐh}4nd&^3M,4~mFv:Øq&1,lOcID›e2\SMK+p7Xb2U{=^MG}8bΗp$u שSt@0g9Y;hJ/\RA6xSk&D(ك.NDZ㸧 ,{t*-m89?I^JU%d˕glV8-;9l5,M9{ɞOzkVcvKuLJ~s_tڏ j :DhW뭯 cMq᭿$ފwLt m%46;;yupeBQ㭾ΞV䁷h#b]mKVYC؀6v5 ,h6b aY*TYIs$c*,E6|9Ნ k@k3}Nܝ-!c,@~_[i{93PLE X O8/4X5vo؞sFKU[߽m>W*Y ݻ|{s1A7_=$J?dZq`Fk AЛv2" }$Nl 's7yH{p{wWLu"LT7a }~e"4H6?O<깮I@ wr-jӹ&?nܸL߭^av7@.X1 q'`X/wX}cH{?،yƼ]802 A7#KAt{a[} ?8 ScY<&;& }<α`V&ŇamA6jf= \syAOgöՈiW;+|HJcBnlA= 0̄m=ܡǞz)R (p X7~q;Qs4'AtggMm&k`ym1؍K'v/ov+>pQ<vF#e˒;vo}XO^T9!YϾ[CØnXFvroD~|܃Ӟ1(U$/`{p/pmq $X.$ۿooIި5.>~'_Qě~b-啇<*ĉQ OOOo[ |5;{_]x p Nɴ(T{S6пrF]ӁE.9!BV9."Qqm_vI@3?bG럣uO58^#@RKG4HD66Ъos׿=MC_(p7pmaF;&io.b4OٺH>hp/@V9|ch vS8&GW\o~ݽ9\mmqc_ml<£<0՝] }/s4r+ڠ۷珄UMIT<˵Ǻt6[indyIX[OKg~P #[bɒ7 }V1urE͏Ûv۶I X s?YAbvm֮w[5W4ƽ1U76LU)ҕ~{m`{^qUe)!LjC-vsƌHz*JaλV{a"i74l;[Qo F1N "*ccnԎ#OrM&'m8*+xH~_ѧ2IwaaDZNRfi eC\58Fk;X}?̈́S\BBܒwza#<qfy8 oSD$ih%W^SLU'#30U_y)|/U8dB,i ]>.ݒ.@-t" q(]ďAycT +#uffs}{ka9uGc߷4dVaXo%e XOo!V?kslzP6ԟT ="G~qvR@:E?W{{9+{+̫Ю-_j hr q4ڏEdV r{Apu nە5\ʸ^ш[*o~ַq]Q؀v =dP@7~G}SoFHQ9ߚ.H QGǞzjsӗKi\χ2\ RI#1<¶],v4ʷ nDV<mvN@&6f rM òEX Q(icOč<E[O T A{=>]Df#^O"N4ڈ=5 MGnyVַcrַc8U#]X0 d_ͯמ!k,dܟ=PV~报Ssk\mM㝸8c{I7=v&bڡ6; |4uZ&Hr>6 Zs7_ϛ)ic\Jl -5V/癮+hg6,A:X؁p>?OOL5$U[^߯8$]HE^+4 b^9 ~z,?==7j4pHX)CE*M$|M'10l}G5kS\ m!.ϵu`<^!nU綣Ӆ73YLP,=[x$efD;S{/5NLsXhs}oos ˶P {kߗlэs1Ƅ8n|{s#|1r}ÿZ&"kmlKx"jM牑ϝ=ʖITZB =`Gگ8emF@Y]@r.7\aj`yb[K}ipn}c<:kYK3reIcv-rAknOʌEkV=a21; _s#6,ax[si:y׍P #]:iR&웂<=zq*w*Z/ u5|Ӎuc(<]?!S8kO4ȁ]dP]-e;sK=>6NGMx7GE$=ż 騿}rI=^?ZvU롵`=ǒ$G@$Qk[A}Iq}XV7%0;@z,~o"@5ȉZ݇w$*x^ֹN}'haR,Em]  MaoǞ~ցY$bC $jt>2)$] Xrۍ8p vqk#ynۿ{c}?O*}A`cano{xP_Gǿ F)LJmEauDIf`~Hު{UHRڝ4v~7Hn:_wKI5jsL?J,Wiq{|m\⡅h {Ȧ72oBmm,m/Κ׾讣sFePac}by/qGVjCGMf7>:^Üq!.ƞm")Dl YȹԒ@6"cr,I[[>TWsƳȁ to7<.68A]/uxyҰtP(B H$_]߿!f]Qȱ7E:X|{o'cj 6}E+GuP@)GW %4 Tv>1V;%ƚ{/onXp睴gHucK}|aٍ؛no8@#pw|v7?Տ<4i5M$qv{n$R <4 Tx{~!Y(/*.lwmfQaʑwR$>HYD:*hPu[^Bcl*-6┙#oD5# wo:a]H.,vJ䫩՘ixwҝH[CkWFΏJ4չm;E$v/ekF #n4#}x kFg"WpXڿ}-H;>OsDҼu|)H JO9v06*䛛qҵRPnw O>QW|6}\8LIg׏E:EO(nS 6F7m=s=t G#1N0*@{Ak*\Nj;9h;h1ˤ&BPHt @?i@xy(fx9/Bn-ם$o~4p`){6tTGEY,esŭ9t\I.AV-nڑK}#e2"zzzpqFISU{ns,@ V߯qbNpp燺;o@vg{|} 1ooˎD+2$}vӊ"H'uk _[[s_l$+Z5bv6X(Kr$^÷c&[ u_ٯꍔ.bu675Xi_~2Wp:*,qu콊k_&b]u dyÆ5&*㍣t"i6oQ՚#6}x͵#N?bI 0Jv v6qr?3ӫ`?v1MS4-nreq6}iEJ۵ʅ&̷i|/C{_A):"6U1dvm'[r}y}v̏<@ۄᇐmuC̛Y/b.om,=#ԒA"6 wLӄ;[nGiVxrFcQeY"M4xy7ֺ n6x[T0u>pXN'Ϟ}t:JQ,evv56#HP&c}i@]=BM94d[@Nt$A?X+~UEH n}܁G>v7ni|8<^6cHQ驫U%K ]H*5#sn:Xm5yN@THv[kq۞]hcsjϧZRpezvbj :x|y~Lvb7/QN9禜RjM]EuQz{;NA_ <ΈʬC{{*8aXCecfos[^ܑSyk {SÄ~֎SB̍6*X:;{CNIj6=\}M0&zxq) Q\ВavיaEH;Ex {sGǏqjG̫N@W&o5m3IWʲx6[r|^aܞŬIq:PMyIr"v@PO9"َѸv:c@?<+yni~\$Tg>#CmLk؛$ 0#NM< Tz%J`_kÎQٿcU72]maNӱXnLpݍ:0+ ĵɷaqL*o6~6k00箟e61&o{@M*k[E V9IPO>:[A=n`i1Ĭl.k= I,oNW.e=U$P[AenHx$[O[;+է,pMm/~{9P"V&,Ih,;݀6W`E>Y-]6dT*$]{Mfxivﭵ ~U'W ʈ%Wo, x_>&4*u ɶTUhYʦ}𸾜 DXmf'U]H37=4v:'k(I2mX{oT M AתXUs{|MtZ{1t 6AN1[\xВ>PnmkJ0զMy@j;_@9M{ŀ)ET^RXy ~`M{{[cZƹW\ k̗fB\Mɯ(b&g:ed "ÿ?q&:*EuIS~^sV >ǔ>04bA?o84- >ZK\xzUO"o!Y]xx{m}9knknÙcDZw=mNܩpV<ŵWK+!2@gr}׶Tv@#PJnHco9Bq6S?Ek$rpokO=5JL#m`o=ͱrۀǞREwRҰkc^`w gMPDr{ 5V_u=8e[qC'r܅pwB. 6{(265D( g lbNumkI@9xTX̭ۈ$n^rx]׳6ݘuyBc͍ŻjmqL4MMYFOf^=I#M?>l1(X+#hsUUU?h)k۹7sTLvUwFnKxٴ~s j_p‹ A&A{̓4GUExܒ{_ǍwŬoz*XL co*rt>6.}<*dsTƌkxMs,r&I#[koj tǺ_Am-~F#kkh> O4Mu"/*Q#gu n$h{_2ko9Aԙыi8e+1'']! H~sRI3@/}uy a}t OeXm2hFw@;4 uH+lMA[[>v׉<ѵ'rmLm<Qu.՘ƎM7@ [_ ^J*g>kvxx.*q1JΜf*I#ҹXf']"HQdh,:tRT$w:}s¼0`s~9/-˩MF7=4܂p)4{đA.WkYM7p睵S]D$Gn؟gl/SΚ0ZwCȲ#.lܝ@>vcsMk2rb! v:7a,ܓBu[弫Q³40&Vnw2T{<}@ 8ϟqYeģWv2t:[Ϗ~fі xᮾtPzNڋSyH'kEhָy$v$\xxkt~LMZ%E?tsƮj~4~Q;pZLβE5K < jHxggU88TevkOBv쵯ߘB@EJ$7YCI ܒI#_5qDmI+:w~]Mn{N,`*wZ٠6>惪ITb̚vKZm-hѡɏP MEQc-CIdL#ߟRԾ8k$Y@fiw+1#U{E̟! w7m,ÿ'CmL6ԏJ(k_02 $΃^Om瞺u#iUZJ9 >жw60P:`~$}Vi#W`p f*-BT5`[㚇Fڦ3<=~_wXK0IE\m8f'U=O 9z9& 7ige0Rt [9&`^I n(f+c$0ԭ\dm!F~Bmo<'O5">H߶Kp6^QvcToԝ;*wξ :MNRm>7ԑI>vxW&&i.lmZ=sK^P>7Ũ+TR 3 +=-h _o(#l(v<_1$TD(- M+}avMN4΃xۥÍy@P,qTHh< M+mr]tN`b̐OW|?y rjlj <f"Z/,I1`dY #ne!o=8Mc=@P6ƶlqН\x_:|.O;mXʃƩ'?׌J;*vk8&='#Sгʝb=f\\ =~^ {˜E"#M4ӧ͕#VY!1I+f mMw2GNUKFoaGބ`yڷf/f7u;RC!*;`kq[ Y'eY Y\ On:Z]ٴ-k~ZsQV**IէIcofߕ\{:w8MRHJFDm FŽif]e"=},I׹jHiꠍ;O$e43ZSAw-{><+ֲ4۹oT~VpJZ_"aKs`4<_!HaMm(XoJbR=iU5=UHĢO>kZ}p>bF3I2TDc(T{wo 0nPč/a챹8;i1MvBnX`5Ny8KeM ~ӎG ~g(i-$ӥd.h6~j¢V`Gښ݋7xk~zm3 @aQxs?DX2/Q%RT_[[|^ܩLS`tSs$R B[J(jXE֫!V]I9|4rua $}Tj9cs Um{[:鰙5(TN[vkyhchc/}<(#_hlOdz~ExY#{\6nb&7OK;lQ)XYm6@{?إ,Gm}`:* 6BlȠ^[Ȯ{`¹XH|!>ӸhmO(F<.׿-3Wko˺C O۸="/{^֌pL 饏`O{A@n ; ?s||¸K+,wjwM:USRH-o ƤNAE?{O~\ƀPXX-`|Gsq?iŪ1)*moWneSgʵ5ZnAXvԀ@׉lVv}yeZP ]#wQ#@GqpV-B>@ر7R>q}6y`gJ]$JǺl;sm!JkpIוٲD"JAw\s,_iE.5xOlvٙF{f/ P7~ 6yjpLgD ߞ*REm, "8׆5鋢&@IT{ *np*|ve5$}8h"G`CXʹ;"H j!Ҡ8TyF/'@[!nłM6IOJahNQc{(=a+E -:q\<;3L0*$!EW'G H&ckOIyٲ1ox~ԀJ5\q5&sAk\am# ;\h-qwA۞!Ccr: iwqLLMOnt $mHxdG 'ec7 ᥭʜ?Z>=8$'mYwi>'['N5 ~շ 춺[mmnSkG)VJJ kj>쬱07 ؞kQCQo^^ߜ%M Xx|yM q܎@Ȼj-?1I(C;5>ݾmG DiYokm9ԫ7?G6:g`I/muxW}]Zqq#"Kxg~qu#[[\w?Gy<)9t$;of̓=PoU5su' 1ye,I7Gw$\=Ο@,47!-N<bzk0f Xx]\l~<دic۳ݶۛ;݈?)\sG`T9<г\} n _[x_{i:8Bl˩e ^t1kRm8 ϒdIӰ:g87m;m~xW+;yʋ @ݪ@gy˸M$rA5rr@YvZX xycml*4m#P+m+ρ\;i}) n5`A$M9v]۾ׇ{yVHkv{c`u>-qyz͕" m|'Kg/{j#jU$m;4 =oF85=8BĈX} {nu.p_cr-[Cs+،GrOb_b$BEv /ovowc<;j "cb׹%Χ^P:.~|4\О}ӻkþ@~a=zXME,ƀtM|k"MS Idq{Gۿ 5C$7ܞOoJ3jOƞ( cVFQ{^'A眡@}M;~\sU6W[H:kKȮ ]?BƖ><:u"D.M}}rm6ŵF3XAgKH+7cm+3[wQo5co>uB iԋ_g8@!"'|yM5"IvV n67Q,fnH 唐q^Eqdh$Im?&I [_[叄aW7sϼȲ-qh@V*e0G!_vvxs; "pV't3 pOoDv}@ooSw-qcn6~(I<[\i[}:uZ&M$Nm}#Kslԋ |MۧˤU>ʑBuVo<" ۮI[hKZq]̲أy&:ܟ?>vd[pԐ["8UBc˞f*iB@%'~Dkx_Mx) {=nBo_e0xtS+<_u_qr "yT$H)Eʹvýf{Tor쭙O(ᙤ_/[h.4׸Ӕ$S$OFџFbC 1q~}xH,@ w>$IuGH+%7mYUE<.$ϗ #R oxvG׆8j(8>j7qbM7pyٻ5ױ$¤Z&x Bne"E#庛*axPخ AX. |O~b32X|5׹o;}벬peʩ=>wӂEjzyUCDIi;F\5qw~$ ~8S{鰬g׫HJOeFckܩ#Acmcd 44G>oE7{ 4d}v7kh9}:t-D"L) U"f* u`?1If ~(N=TJN=>SWձ>}A]Xoߞmi)²,(Dvmeýa~έ4}\&+Cl )xw 90cG)BO^n9)UbP-{۽n.tiUSJt*L20e ܍u}hL;}R<-M= ;7!Ϗ pxF8r}"ARo:2{M>?3~_Z9r0N>FZ'1nt-{9{4&r>tlH06>tU.u+޺_A 6tqTY^=M| qba}~8 t#3Y$x~`crX/@c:&5mmo`Z`m=]18 yf-Nkor,=O)T+ LN<:ƞq ʠ#0IsP-p?gM%R_gB3`ݭHY2C31v_~ :)n1=xZ5U4Pw7mA65'8aWY cNq1[oma̻[vmXffqnTiu6ےJU@vnn,A9EOTvjc.$4-u"r᭹/p}y?!<9|k yToruSOm)|uk GsdcdoT$twjԭ-6v]G1'Aqp.@iʜF8ӌ4ҙ%Y1_K8JAlm/R4>xS r9);$${aR (-͍6}y7BO@>O|;q lsǞyQM$U{o<Ͼ9ttBot:ÕVjKYtw9f;) O`|/̌-vub+$Wi{i|ƆhE[ M'wY%hg{YH Y{kn$$m{^Sg ɵ_l~yɈUfMͻ}<5U];EhV)oagԆ9CI=,~cw]>JdVA*a)7soG6>:}Dli/!G*m}O{[xеԟmy+djS/]l{~\V]uQv.7Ǚe:-ŋ{EƄ9q JT;N |9mN5^?*Ҧz"*v MqnrIM ;1[*mk^?=]׶ǚւI۰}I#Aog9w1}7ot"$$?}.֢}BÞM3F'Mmv!=uj3* mBMƚN B4y nI#_qXs{<{_T]yqT{lmk~WGhFGÚH1P[sk:x$Eck-yమlɮKo]E "D6F kӰAV? e=@}> e&ԓ{.tp睴le s0t[ ^UFc~5-!Fx/ۜ#"}c{h<On\'$W2xkS#4nmߵχ( X$k\ (Q:clċ 7w63=UYvf@/rnfhA& ߞbjQ,ru#hrܞm@z9 2Jm~JiS~S ď0Hy1\8ăo^󃣩` ߥK߰זZ"+ ACx2@J$~\BYUT$qaoi!*S}^>ZGk_iey)W0S=3S8+L1׉d MHyS*oau:*H}oi,b(F6 mm/Dˏl'犤ȏZtTI$FbTwÜ'"`5n/LtsȜk%>ye Zye1 xL֧܁eۿ{Xv~+^^u5AQX\v'ǘʻHkmp7:كy¬GMaP3mANh6߯~>Lk2mfoyZRTg&&?Gؠ!7osq8p4Ɯbؗ2۰̲;],憎og=\WT^CI`Cø?I!ohP<ꪓc ЋxwSbFw MttϾ'n8VAG$\.m{ۿ9 `IM)۱g59?i>Q c"cqa=ytUTb+1]^mo;UT`EԐosOG<*0# {==ߑYPcm~?="z %2EoMԲs WZB t9a |UۺdO 6ta<{r)9 <么mmǣQII>"kbyX3?:g?T!igadN'6C | -$}(`Rw A7qHذaul~<É slcuP\ X  jA]HqOێjV9cٔ;?.rDOKkF֭쭃\%Fş7>xsx k~_gxr iRR9g[CmN] `li}n{;7RFg84Zk/{78c9z$"D~'K4g 𓲧D .Oýל<˰/s~rPwE 1Gq`67N^KXLMlH~lKsT\{O[ @jeNÜTH$ kS\r~^t B*+'󶆷o?_pX_}ulyՉ VY#IJZh/`O<׵~~sVx־ԱQks{b" dDž5&iFm[y]4bI@K|,pr}ky- */c@5>[vvrA ms>ur[ Ā]m9~RHݺE}_G}ođm>}Xac0vGʴMr0#VR̷7׵HZ~ ~۞hʨ۷}c"BTŁ[E1m o3V5rrt&xsq9X+ed_۸_{dѬm{V:+Xcc#8B 77NǷ#!, 4~(dU9 $k &k`>t*ڋ'Nu[iE'hE/:J$0l;>\5[n8H#mPmf_t>Lєaڋiqn ϲN I(jo{[No2S0J2kr4kmeQ xXi]X7o*!hthHcJ1Pig(XmapX4?),W|g,G~UɷdA8ע,-x_[7=y۴$/T˰#o᳟JMxcT{(#;a׽<:ǞvRh|c #Nuꠛm؏7hm-ˇ ƻ j}mq'sQǵk,0<Qvm{9!C,A"4_ Ef4(\ HkےadVB {{O}Fb'qN&,*I6hGr-ko9[x=5[:z~S5+,v'rv0$о"M4-p&mKFY-rmp+i[HY>eۮA cobWs]V:*:QyUp]-`o:’h,{O?%bc Ѥ2MHokn|Adxٱ6^>yu?Z P⡊yI|trlT|O4;q"yZJdעXcf]7 @oq*?ѝ<ݵ>G~\}D$ 1k݉7qŏɖqcksp{m<)SJ^[hh:h}_g8ʂ4\@׷5Î>qi5 ܋X\Í5 ǵi|og2ִ FqY0VIԵ?#rn`Om :狼9Q]@}ؑ}47{ͥ 06=2͹ԩi{04~(1nb6]u"$3KX*c#dRY}o$vG$ٯb=>}1EVl/ Q:hIe[;Kk ԞxcA-Dj,io7P-cKkw$}v|Nή"H$p]Civvүq`׷q{1JƦC?ۡbkq#"bHǵ7̞vuSa\gSf׾E?hWZI/{?3 p^^9"6IV6?@X"U:[qv|8VVJFAk~${}01=_g/>uᇕc nn\{Jr @kϞmN+*~,G7h̻oG- S 7ki},=XI`fcs{9Z&kY\xi{s/c܆ uԟư9ƫ<'1D9PFwG~w%SKv=ȪƝRB4ex(dHg=l¬]4LVܝ6=; u;旨LP Xt:x>q*J¶K'_BvwUF+<1[[<ϑMU]CJoǠKƒG-ˆm>us©5^#aRENzi_O[To]BnHX `Z-)+kǃd# } aQ.P+%ٵuǏs*ݷudUMR4~'؁o X#Qq}\`ޞ"!X}R Ѯ}V:i]&R0A{i9eCHڂH;e5sºZf W*6Z}C:ɔ(cmn?_g*491TQ<:H}>.l /n8yVZx%6'/ 屉I}m}qE'N2<1E(vXǸ?_yvHZW=c#q 3VK/ x|=萟fɸKr_?Zbw0b ,Ο(xrFX|9as'm46[ o^W:ƾPu=?x@;AiǶ CbF'E"ďu7>Kh5sLWX*X*G층AYc .?s7@B6Fn}g$,d* =8c? v}ǵf?pVŃ[@8[Лn ksά'}ӣ@ ?h_9,-`~WOM9+ӒwuZV.0][sg +`ghጊ!p6Rq}~xtnEŵl·1Ymƣj&Ƿߞo/bKcb k\썱?&6~dmvڶ'_s#(S{nxXW*"E"-{-h䆐%k{O+k$QEm!Xn ԋ[9_Aqpʝ+tlpԑ:6c,@Z1TQY4$6 >eԑ @U:?Z]GOr#Km{<JEvr,NtYHRmpA6MNhbŅ5kĮriԉ47$ӨMF[DTS)56xS 1Xnz+o.6w=7e|bR}8sn:΃[-5SU +quEx9JXD5-b/+1K+ZdFMxke+I젂~:gvsTj\u9r{[OfwʙsΤ@,___B=?gf X=WWLyȽرЁr{]6Sxc;=?M R#/v^Jbo0m`4q0z+`aP }u"=)$A sbumn-8VPR/|(+@G"TƵ_~\'8 ף`y/pt G !O~)I]c0aFxDYXcpAיB:~#mXAVW8 Ig6Dne |nCɹ}<j e'<r5=5REF.uM>J61ԋv@<~i'U:[N<9hg[`ۘ Rpt'|xy\a`%A@k^S-x"TKMu͔KZ@'Oe2p+} u|&8[yu vo}%M ~cUv=A#;YFNsM58_%[ۛs#yanXxD^X%suԍ&EG $ x|u_(1ǯ   [ANv5Y{_o̓ytAc )Jo oN}dw&9qՍkn5"撛T_=qsկ} @DUS^D0 ŇvS(A,t"y*%6 gqoV .ֽ_x'~FM>R[ߎMM<|8Q&"xTۋFOϦDӽ yH,D`ܛ~@ܬtAnǰ=ߊ1#n>04aBMd!{hꍆO}\112WAWĊZ TYY}>EžӎfǸlH'M۬lnO^q 7@bF5Ls+s+wsEկn)c2K~ooljʣ“(`B ru*Ğ˥'%@7ۇkmOn3:J8yAdՔK] +"2ICYE%VYCE2Ga6IGZ =cz-nGtnKse =55P&Y%-wr}9S !={8 MwW&nb[n(/jo`ErG2rͽb4x}^m /;nntwcIk qS5&ajd쥘GBꞖRP[ v,H@,@_F4 &)RqÞZi&g$u v{~EXT/ qfi蟟3Rt۷Vװs@ $Xn< }9ֲEuu A﯀>Bkݩ Q$MX˿< םJ!SsB'^Y'hl**aasXma(lHx$I x@ Yɐ e#;Q!ٻ8<#M6 CUsxz}kr|\6q9zCX~=ՎB؂,u$=[^FpH\0h?!=Ya{1:xb۷쯀ǿ'L3Ꮱ2w6vZxsqus"[<0S4U:VQsc2n2pǟZm$O_*<(]_:7sfC?tjͧg s=~?W߹@5*чOs Gan4d`lGWX8=ڟ{Baw؎9@?XH?xn?x窌F8U{Y!A"IWu&_O!4\:zRD#gG>#y;8U+mtGoC~vD4bψt,n{`ݎrj6Nqo=eQ"fy{ilfKs}3ndRRFH;D|b\LŊ?q o`{k٧GΛӴ^&w߿%ČeU;Iy4q>]Fl,,lG}F'ごKPmmXA>>Hշ֖LsE@Hvf) 9ՌsoL稢I[sHbOOӧcxrh^r:ano)RVMթ^i5L}H%)NU-2ۛ q8A @Y5Wf">Aٓeɘ²vإƂ5Qrz)y_+m*I_c1B_P-nob&(TU2BZ@M>'ꯙ`TX6o}͸sUh;ũMIHk1RM:jJ;$ziҐSy4u䓴~-9TQ܌^my*hb@0  ;Q@fc?:o3(ie v!=ӡ Q:;icWk!rA$eE,ۺoʑM[QF̭'Hс{G$aۦ}.3b v<h7 mV+b\_mo2ǹIMw_׷R*6v7'|-s4ă7{{l1ElOouɸ̵ rjb "ߟKHR+|ES^Z3#fԛw}c" 5~5*C+9&Us"+Ŕ m>h{m` =7̨6 K۹Tb9Cm[JoXX6;xǺc2@@B/Qs >;mp><=讣 q,H]y$x[R@W'mVyk2BrO̊%RH źX I*!Eױư$>XAm\MF lJ6xgۏ<նWcq_&y&;.I:Sev\р 9z8F>;oǕ<ӧ+w6;k/b4p@(%k[R{ۘ e{>&7׎H[쾟H3^[ _R6AƠsUx }HScqCc/t]]ǷRO-}l,5<ob|oƶ}IxondQe/(#kYFPmZ v6-㿏xr2bvX< #'.{ӹ]@8{i3\F#Yø }4 Si^!&<᲼+8p$_s.޶'==,+cWe7qgh /_(ۭ:G9#YA;[ֽ# ^&<#m]=]5eԄ@}X4Ȫm,vBM{|-$FR]۹76/uiȭƪ]i-bd"[[]>ÙrP6ݱ5ϯT l<5W$*@< I䬞Xm;*#UZŁȍK0f6k {@g W'"wnf vr}.CXn5ETsYopxac"6Sqˁ<~bbspM}ے`  `OoogVK0kXNpR$!Aw= PV}HB^R]y獚7dnt8yjj<+*>R F o.Oۚ1;+e-Ødx"emliեdֵ5ICݩsb;+ċzy窭hk{iPPdXo&GΞQ2}|;_C-w7v񶪪)) YWN7cXf1ytf!TPcRLM6qb5Ӱ# yhmH6׆>χ * I~~> sea{1tn3yPorGƵf>5WbT;V5}U$/6sǟ*lYifR7X7?nuQ{x|H7_ͨWJwÜ\2b6ZHXsUk4)$cm?vx{m{ߤ>Mo`TZߨ<V6h4K\߶$*bHtx Zj9Or |<_r@c7M45 pӰ٩sۦSX1\o!7_~afVPkjWז8q BB} @A&DL+`{>>hDZ i G6vHע##I*7}|GcͱSryn}\qZNűΚ+njY:F }c#TsQd 5'2WŒ$ϸX5±N+@u~x <jV*\PYN[o {lxgSoc EoGdjT7R Ypf$O<Ҷ%4k~<g>Dhkd&X(t۸ >ĞEQqiw?[r:k)R f;{v+.VH\~#ҩy V3]Ag ۠>ߡO9 A6`nu}/}?y@)uZE7(>X؏Gju麟<ݔ [$*Ɗ^xNeP6nn׷sa~yXy*G;+ Up$WSp5}n5tcas tӁ5L@8FlHN4MY'^}ܰWJzyMU-e?Qr\A9ڬiH*dD[qϽ}|=ʰV-[ /B>^u"+ȵE\Mv:kkvUf ZAaaoύƣ^#"0p͗~^w"0}; `A -2EMqs'-C6āZ +ܤ-w7sT\|9V$i^ۧcM[O[kE=*t-]OM۽ᧇk aZw a~$*j}ʒyG_ʮː)s` t-$tREnr `~={h9k@Mzb"]w ^w&\M o۷b04C C\^݁y!H~j>xUSW -$F;A6S_\|*Eej c5f__E7qW6Laa禕C(5[ǜ|uD G}5^<^xӂK0:jFǙ")07 ;_$}:;yHau-co uDbLtV«GѮ* 1M$0S$=4Gie >+AVF-C"w.c*JIo\P匵S-:-t52I9FaRXtj׵[GŽ:*. KIZ^Y%ZK\-Tiacvc[T14f|:jjhjvE;t؏i0eK\\.4 Z(9IO~TRd\؍@@_Ww#zOk{,{ʈ)(H;G`ߧ%FH&㾚h5NF8uEl"CD_W&୵~{9vڠt;tP ϖ5cwT E-V$ ,:64N"=)0R28K+܀$6ip5~a@B\N<)zThbcqB=oԛ{ !$}lR)_/T "-n`OH".[nj(^1\`p!km[Л>mkxs!7wh>;"pieeX@hߠck{y4"1&iE`劄E6 V(i}~ՖXvEma^G Y>_t )Ҟ!fm[*̋}ubG#:~TN f[u$`I+HM|{{8TV-Q67\ ^`bFh_ewu4פX{SovwjޥX؍h[դY !K$mo 4AhE_~!zϕ4@' i$촍/3 `]m]>1Ouc[x[n}Jڥ8<.YVנ'$smO8<5**M Q`-ڦH :m}mk9>(k4Q( nb}#ru7[H\]u=OX E;1 V-Ŕk;G86NOψس + z+QXs&![Lc'gov'-I8RȠČ/ݷK%jFUmnIEZya+^Qm|5s#y8v"qD5BWb*M͈O$EY(-M{rR1U+4b{N)[lcOVv:H'_sXWeBYg;Co#iMo~;Ʒ#o=u$'Rni~ǶPB%\@k><oe p>˕jz?_^}؞[Ckj-ͪvsDy ?ҋ6ro~xnXol8y®p idX m}kl6UHZxh8q:i8ԞĔaIUg1 #Ǻ߿B˦~?8cE8Qi5q͒;3om-sZf5 bMߟv3ܝH\ǁ+GdWrNۑ'޸ð'8biFlTu'KX\v6TOo}PxVQw",Npw!nHo FꫜvRU76;us^$}Û'eC)(nOxkȷNϳ_*t26>=sv:v4ch󪞑YDTmqƀ۵,A~ҽ٬Qb÷:,h|/ai͌GhcX瀒Y7[Sc`,n ZDknn}*F<*VS\}Ù*8*}ӷkOG*%`Zth5GNb!R 7:x=H<nPWh'B9J|yz6VKzut"{G3(ݽ[؍)эB`"umtk*I4OLyUEsbk2FE #/k t6V#O[vcqkvO-UDEcכǟe[m6iָis!6KܛGէ*=&V'pM>#QQ}|G÷ڧ~Up"SQ[ UQ_d}vԓRt?4tX:m|l6}7'|y9=̶ x{g?:mbg:,fﮟW4q {@j5*'-`o{|yQ?ͧ3 u#\۹||yZ1)$:G#ǞyUN4Y$(ݢ ͮ.4 +HI鯍 )b} *zt&zMg~r7;۾f~u?&;# *\h \jC xܑm3*ؤzPizz_JՒL.TEݼ>[_ F8V+m[ǜВ;grWEc!1ftñÝPn (v_g7Oʼ BzWFk<;ǡ$sƬz9PHHPA#kXioߘ6~ڏ-aYd*X[rtkv-v#x3UqKR; YA}uQv[}Nzq*S5T2i{9dX8(&,~xI>Gl'4I61D *{~oSu& /n3,}.|,?SڄL=6 ˺; ~{yXO+ G!S`;v'_[}laa@=ѯ73jPƚonӑTOwn7[tSj8G³#d ~6lʑbX˃[رÞ`y&Lq& e-Yރ@nMZ8qlY[h^eyCtmr5vמ;j󶠺, :GWǘT+嵿{v?̈1ᦣu3+(nOfNf{~R8` +`<~yĤm~kƏz d3#}ſuǜ?ok p5lDx@>#&XQ ϻ:rԄUPR;k T66_ʓ<k *Q`NH@n`Ga_o+qϝp]tl f&Q/oN=TC*ʸ:|/yEfW[wmXnN} ʌ\mooW)W)U݉׷;+;EQaqf${ooom9DTǦޚ9TK]YBv_兟\`{O ØC4+)_ ko`)oN&k^\)UZWozH&{ryj+x 4krE" 6rmsS' LJc B?G .ck.iqϝh 9^܏y\{Y^kd.55m>m2 XuV%P`\~E!K\juMiۛ&y|P$$ uqDe6mX79}rku9`G:]XX8|*Su};{yg 9*uJ\;i^}7綰m} ='N6<4HzriIoqYaFBlux^52co<>IBA޻=m`E'=mdaЩJ{|Ho:vavN_Gӯ<*M@om:ݏ;r,|.4`N5b_,F'W-rTl~;<#u7c58|UP CE,.QF[@~'? ihh]|< Q4"۩!O<X^"B` isC ܍^ZG/s$nԏT?V4De#6omYV;TwBHH4M ³_uV=V)j,N:5#8`,|?S>ډhqp5'Ά'qMX+f+4*vosu[9%xPo{r MK*' ~* 5<[1L%*Z:/ ˹v_ :<ȫ~uZJUJr|WsRmX۵Jtp[x+r@ǞD E^;y {kF㰄 PB _ǗNήG;kNu $s&]Wk8#ID.=}6E 653 z/u 6>xͭs{9%D2l*XS>t&@良8fcsU <)V0hn}<_sV6~Z%SJKx 9cu|+TE( f2ư A\BehgQ=NJjXPݡ΀i[ʬ 5mxfi#y s~u=E yv`-o"qM Ve2#1Wm'`-r|>9쏏˜Vv~`g*!bvm9cc߻Lt{jqOoEy!{̶, 0Ru[x<Ƣ ~)P)N8lƋ N8s>R1ʌ']l:Z^(N=>1Fm=S$$%śu i{wq]Fco;LtHz8҂k vSpt m)^}|/8)\mշr"HRK_q6&øuݴ~YD ?^|>Ƥn:{|;">n4siN1MsVtw ? ck35reoxmq?nr =s_O{y~hp_y7X}>$hR%ᅬN=“wbmWk}^6hv>Xn 342"Y"11bIn|{r ggrB_V.4a{ZE=B٘^ڃ}{2g m#o=\h՝(E{E|;v|9O85y*,}_zŒ0?Em*)aEN 1q_i:c4o{=#Aq [c]#؟g<^[t.~R=Q"R.>`ok^{8H1ď,X9\{ te*pdt;C?Y?w#É<+T0 m,5Ê =}tN\OynTt[I7:>${'[wy<Pu sVP͂Bc (oܟ# cvAf]=p+ MuPM I,Zǎ9 XeNh<5qQ4A\&.\}MnL,l k{@=GkDkdi%Exk؏i5Q܍{##hqLk*&Nk0׵y,\5}ok|8QG=_?Xls]Il.T6ݺJaDJF8b ;@:ooqdxǞucgj6O o~v'[  4"W51۷|g5:]{[OȳR0;"[%l ăRqƕI{*NC# r.UH_sPw;v:w$ȃ5u\g{ꥆt0uytli)r$$ y>9 ~hKF}$3P,5n^\k?$huMl=qWq`0-6.7 4еO){vÚQ6sjq}} &}><3m"Mk_?ÉTHN9XH29"ֺO%BŬ_'𘫌 F5*nckxra( <8b)ն|L9omԒ;~ɁLl cIcoPXVĒ4_M΍nHC]u],/64T_GbnJܝoIE`\ܐAm "P喚{ v׹!k}}xZ4Hڄx7#hdzvBMCWJAMF#.5o&f76b.Jk߉\TiIx}f#Ù iu {;_q*^k[3ݵ_.tIGO1[Qg0جN6{Y4`u|y@ 9QUHFo E&s};k{+ S| )AkϾX^ݗP-90rE "GnmSUqw.Ҥn;iy 6~:bkGf5" @ȭ-~~{^vnXoqp}k¸4Ü$VZHRuWkQ AbA-?)AH67Oݯ) O+cn{mŷw{@Ӟ5dMq)"ߵ~=︳qm7ƾ?9^}MʏB!H\t{[OrSnڬF5eHP߰yldž?:<+l.5 _M;e6Qg'r_^v{vq㶽 uV؀M8EIdă\?n!4:(;||/xH FWX]+5; ݬ;>dQYH KGo#ľw[ӿ=*RI"4];[I^sϾ ;t{.}?/l&I*.~p*c%Y{htx}3mR]^%m__]͏pư`voks!6M@)+bK {<#F7 l.57 <}6mQ{{9Te{6MaΖ5 Ĭn a?=\5݌}Gb4nc<..'NZd ]X#_i*x܀Mv 9i%d>6yDVA~OŶd,C[?ebTƷ{A>My ߕe?k݅su_@סּc^0kWa^M.G[»J\m˺^4NV渼p(.u xnx a2>ݏ϶xTmFǶs4ex}G l kRm:wyygk\ nE/ 7G*ؐ.-c9"y,mr} ?^1^O\D ս {nOyԢ@nY& Wy5# ccO#Ýp۱"yV+VB )6@AUu'i6~ɚБ\AOÙp*lm>_O<Հ"o2ab}o:,j(^ک'@;6{j&1 |Oq4λW"7}}sCfʰ:q$jt\CG`q|:7q=o<ƨ5TSmo9)"C^8Z;؟xZPxR_:htݽ|DVH OOx#+@U\[oNT1U[fmH%AGy&rblt$?5>X# #MA6דd*Zۍی(S{)-|/K 'Ǣ*f-k|>bo^#9ƛ5@<ݧ~cyC{Ks#^d M׿<)#$yli@f5$qGԻu.o@DZsiӓknIE{DD- ǰ㞜$6k;)*}\Ƥ+Қ>7Jb {Go$Qܨ6O2Wm p0*rIdLiAA: Z%=k[ǂ0`RvK϶4YW7:y57 Qm|uTALфgw%XӜ]%$Gb9`b8cyEob }qA4Eik~>`sM$$5"l~ÍA;y\$yR)+u1(qڋ䟈זVpx( >`(ts?£l#(btp@?FVof_L~46Sp/0u~?eN -`l[ MeIGyqv>Gp7LUǾ[CvRl~a1׺aO{<æp41K ۙFv6CM^"ʲYtRMcF -_JZh:Xۻu.rD4x5PfRCs &Z_2+1ia7>$-9Xϧ8Ӿ\3 :M\]8W~{=BDɧ"FPװ]=x ȑ{ڋg TyÝ>Ӻ GwI,O5$Mq+p,m}\*ǧp$µ]ҕEMox…6%v_Tƍb=inHAS}Mjo.Eݰ+akw+Ó[1SB:J#YHno`H#ܛi/.G>@p[RI썷-cāv:mAq(jp ݁cnxݿ>eTM=pGÆ'a8SZOH* jw7slU"EKYXDDUvNo((qʪXbGlK.X(y3p~:项 ;i*1;%*Z1j/}/C]i`M A Q'EXuW7)I FmCZ 'b;[I:m49n;?3 .;Zkj9)MKks{Ñ MFw * I p}am)`.ÿaiƙ£FtwRA$4tʔ?h>$ |N}JP+m2]Om~5P˥k| |xl@*Gʊm{ܵO˘Y U lGo_gpdO<񦈃R3n R-0X?(,<<+S.6.#Csn46ӽq/5AjZـW?vlXXڎ /&RXj[ժL@mC?g~(prA:W/DJla^f@"]#]EN#p v^#ă8G?mXcrRh5:~̎@@W$7#ۨ$ X]wK}.r=+=Mc(^Ɗ yT$^l6f(aУ"έ#0!. !C ~'ۂv W@=w<sʃV&NpeqnC\kkų f-snxEy:+%ToITDoՑ-Aw}l }Oӊa1E$ )Yfarh[Ab@:v$8kI<:kd AQoymi;/RgpX j|o{" oÎ$FR9M$$ccu$I:[s$PNP/ycm\X%ԍof7[ ɘlUSs9aD|iXcW]^@IXE aH6m-ʖ,Yj)`~q1+($v{}NoϭPWd {jboy-e[j m~' S%]tr`Ǹbzk,# m@07:[E|h}HíM4;Tv6n춚s @K}4 r1j+ ٗQq}|7U605:XS<)+F-m7Q6-N.og?¨Wɒs6:}<Ģ#Ŏ8U* Ӡ+F/k:/o8(ӱֹ:vtk HlEԋ<}{Fm`[÷kgowCrR4Lʚp1-{vK Kn׵g5vV㲱嶑o| O~v[zc`>Y#QN**6|) !RUIn"4']ny\Z҇${Tnm<`d 6]l9 j#Xu+i Ǎ!TGMoo[%;0M^iI]U=6S{M@~(๋}E^vKƉV%**HAy3 N7؞Hxy5E +! ,5Td=O3&)1M2` .7·꿅͋:M׵Bt:\ߕ Xy]On K_eͻ[%V줛T5{mEV$5R6{=:m>^j+r{ ,uNG7B;xj}G*瘩1omǾv=H1/c@=7#VF ,v[nK;q!;[vW:i^8TĒ]O^U}oyvSU̫r~|~qo4KۨrբIHH7\DžrЦA7Aѧrvն^m,/aoau2H@`$ xǝDHǎG.xzS3-L=9 A{h+($kcml; ~7ה0N<5Cު7/k|{k&i@ o{]-^¬1YFP,msn[Ktݵ$<5]T  ?)}6@H7ʲF7+9G݅υPט=\0_{򹿶ݹF"xVmg4||tR==ˊzk+@V6'xv%#BO|~g=[ى(Ⱥ@;xiÝlA>ӵh7[O3ZKߵÍjyƬ`YG_ѯTk|ĥUء m}G]TAdM1"iն[_fk<3['vHۅ:@/h'۞f"1U=P xaOp&U¹Gk ̚a:̑{q܏8m\*-B2kE]-}GʊZ;刞}X1O-. 9i[- 5? ʅiUI4w>dF ~;"(XX _Mum #|:,46fەF=!T 뭊O%#K#S \ͿsJXO7oQcػٮ6'9??nܾ1>]r#F|kJVa!!8ѭo}+%H~QϾpR19郩d>^2ƱM6 6ZXi@W&N/7mt& J@,.vZ4SSR,0 bړmH$Cakvr`ؿkooi"f)P==ܒǟֹjj^4,=k ?@*p5_XВAu No-Cn|8d*6A  P6Ut52PUE[$ﭴ"W 4:*) k tZ|i6{0>~OH&0bf] M<-sPQpO+ 'ϗ?,}E\*`#]o6TvRU 13N4r9fR-@6nG}BC 0"|pV=9 +oɸh5#6Teaѥo΀,TIdy)Ă0;:z s)cpd@GK"! pR b=XT8fd\m`˷q6s,dP{qz= `zk-PRx~ =׋Ry4ArE)Qs؛ SH{ׅ/ѻ]_}2*$ 7ӽ_o9G/ Kr4·Q<.bM:T #]xyX#o7K`)X)j|x,1LAߪ>=rCRS*+h/zS"xW8b .lOjC:xC*4aMc,ѵ|C{ mߜ*V2wRWFP\ZY$dְvW:6?ch: n4#l*bnTaIqžX|yGYVJ rQXF&lk & ron,@4ƑTN7Ik~9cī28sxo6;c6ԟZF[TwXO+a3EL"0sS}x5Ej)S`.O;DSIʌOeLDvl-$M?A !#{ 6#xm@І6e`IԍxC =qS"ڂI``@tj8dXf8i nqߒѨȢfQ8خc~ϻH؂7jO]Aqp:?uTg J.a`Q#m(P Xox9ǫΛz\U.$&woаݡ5ȤJZ^qHW;)ÎS:!`CjE~ [Ȣ+Gn~ARH'o?iy;f{%س%;=52+1fڝ~ {ϧ3*Q@AsmR.EO4 'v"6O.Dzϲ "<f=ߵurDu+!&B\kpFԟ2Q}A2<@,!\\mb^P>s&SMŭhǪ'Ӟ5ȱG8[R/yV=PvaXrvmǟ~5|y*SHy[ЎKrlA`-RHJDU6s8 Ak9ݦ: 6Ob@muUoc$ǧOc)]I:(ik)7+|&SʃӷRB?l wb-o䫳~v1xLuį *IpyI?L.AaOoh{iK~p<4әM@8jʶ]ݮn4k$j<0'gN+yJ]5?>Ie>@#q9QvʯhMR{G+} 'J:q#2Ol!ڨwoy9(Pݮ@qǟunzj8|1Qbn7'++>&ǵHS"4Ij, MЎep-I;:碛^g%]-76inIi4c?/IBE3sbwkxސ~ldNplFPt bRqyXk=}y{Q%܆:Ym'1 x&pjF635sl 爌k`MF$NWaR$ǰrC*) pH#B8<ӑ;|.u=^øS(w#j_|6'R{u=H6{7_+w[r ^Hآm.~#٧*DjuC70Nۯo832)Gs[jFʓOJā=ycbP$XsEXcQIBa{o8*1v k~xiMJUKu|~琣ň#<G41Ǟ}]X"#hAmG25yv[ssmN6s۷@Fm~Lյ~5 J{&BiOyR0\!!Nݾ{w8uG`nYon8{ Ug6ǽ|yΑXȸkܦi oo؅=1dr4s8MmI@/{e}7*dCmEƆ_-IUʲŸPY|yn\}m\oʡ9M=qN÷9l$ :/`{[moSTsϝ^}̂מ@lx grOri]Z#e`Eb[&ăscnNqnSCUqo{޽ohCpYv,v]|ibʌX06lG~gy{$Rk~j8ِ*H:`>O1Iw9bU@\xAl|iteUuX&D,&C}}吝&=y|8։Ʋ{}mܶH:}]ʏk`#/m><$PD$"=9X;:9Zx}?bk4Mĩ݅}X`&k\k(t/$n$[BHEw O qJd` O\ws bʪ[طN_g.}$\l[TG<-UP5(+0XOoam5;<^DV$Xm ǜ ۹7rLrN^^ߏÌ8S&a )'_pW} y$aϕjgRQcU Xk$vwb ~x6WXYM A>oo{UN8TI6k NiqB#6{tНmc|*ؚPD[O3iSxut~5׆kdaw 5O HF.Qr4QpaC4u.IAΦx%(wi[U^F#K뮜vsJ㦋%_jeE&wۭr{󒨍U/pX>t}*T|нq ./?m S*BQYJ wD(0D~3sSM3&f`O0q `m4~><:r\Su ؓ}\Ƈ`"?yH~v8SSRWGunO|9кV7ɰ5&30#[qa`4,nOs[8@ԭ31. Pl":?dp׹lMM``(Fo}<1ED4AFӽ[1#\5—ՈM^G;2qf#p׹sk ؝ /Qo:xچ4ZlAKb3XJFhcm,=Cl} ƝZpvsƄG? !A9Fؐ;~ƨܟÛ8ՈOMY!aPM?O}{dU@v7 k鱗qx z%.#>'ѸVu'O_5`j4iTkMؒ咽paNAQ٧osYԃ)Uq.jJFRaq>ֵonY"8}'ÖN~A{:k5Ͻ#[  @o)PA[oyM`+-D*/ivP{mk\{o-)PK"m$߷8ey6hx`Ώwʣ\cUFo {mۙlFcyiO>y¢ cpo X}o"Obv-ptsȭpNGՌ{^2oBÌ,~XHÞM׵75ёƚa^O!ӧ9b`<91NiĖV]%oΎé݇xߕڬG>U%Ky:؎ٯssIR h oM@TVE [O{?e6~_fp)B\nG9Ra ӿrN[ƼȠB/mNۿ8X \\{~h M H]t_Sk$lTiu?_fp>fJ (nCl5ǜ cifkBk9b {4ZsI_ ߧ5:?ȑyw|IgVuec -}4Л{8ۘ'&s*XeX %IqYn*mܐ,xK0n"&xZu<.Q*D)V妩:,]VQ;|lNu_N1蘰lKmh?ӹc[<ߥ8 TRf)LMR Fqx;Btb$ GGiW.򺐰y+RKHI[Z[ >kk4UWŊN-|}uvamo}.bt*~{p$Wj[5>D9nVO!j/v񹿇#O*$cM*bTc,$ͧ[\iT'G~Tx5gm6Vu. :}ʬF{Of˞cZ$)8iYG܂M9*6g M;r&evR=>=~8QʚvmL{)pzeQQ3\l6n{Xwm-NuΣO{q`RiSTE=3X [kۘXbG @Ϋ4^%AlnI"ժX('Zx6QhB€4b.8ܨO)N"~-*v>T٘0@Q#)ka{ ?Eauw~XLLId2FF5 p4sO,RV{|qXtϕT0GO7|^1{ů7xqPǪb ӭ$BqاmFhXx?O% ji쾣`H3Vc]1$wV}6`u[Oxwh=<$Y$xp my ǘ\uH?::h#}isv]o65B&HQwvJ26&Sk.p=Tk<0(;[q["`v{}/NqVDSǧ./[RFRTf"ӷۅDSx,y!mܠ1l~H&=txȁȯmT1!is)$noksAn=GLy֌T6Fg>lݾ`<\bt=q*ɦ%;eѶHFobqkauyG'MM<HmCak؀os<1W@I5uH8+@O Ftw7rMXq`nHxdLp ,ݬFOeyB]@"~\d`++F1D7,n}_4c u?xlS|`uǹ?­~$; iWPFHU[>h.~ s6qEF?[SRjn\Mmo0hlmLyMfZ ,^fֿFCToIVj r i]E י}!ѻo_6NWI .YT;Naۜ$pxb<,eehE^vl۱|>^xlǙaV]82{qkw\+o;/}ְu$I~5@X/=ɹxWØ%FK ˌL:TGJɸn;lxt9omJije91!}׳tk;s)w*4>+xei6n*w\u ibRx؛Xpχ[SDFG_26P. &ܑ=&.upõ]x#M\] Ͷ*HoG3JŢۢu:kmo}xaXԹZ Gs`<<;ӑʨV[:koe8cJzf10C(;Gm| V {ˮ"ڎǕlLҒp'V/K4aal,t%@=hr M0kXt} h\iTC 6INJ3 EMnr|x@j(| ʖ{Ng8ي{0$تɹqn ( /.tIprF1i?'-@:_L9ʲ0CY,` ooMH(tj:;+枑a8#ՈUS5x%C}oWJq_ 7;O}[[in[0h7s񣬹 3k@sU ۥ{sz@O8V4NYIW sar} ;EuӭrƤ0nB.<{ZO8} -w$Ud+#JK_q x{o¬E@2Y$/{BM ۘ>w]T5g ƉC_~3vbM㩿nRksX|X2/oX{{9O}#oRq¤APc%Xw>Gv@l=۱60s@b67lu],77pOOyw\\H@H%fEP/pXX]@<펢{,;5ӛtI!M: 'Axaozb*6-?}ߜK?F|Hf&k"Kڠܳۿnǿ3FY7MqOը׈>>yX+*M}9P"tO};*[/[|4' ?ؗ9ŷ+gr~HCXo/H-a}A鿏62H4tqy%TM!,kߨm/x_xa 9"@^(̘kiu EE>}G1NooҥA: orװ8gv,|@Ӱysm6ӍX'}}B肟:*Z0=H_ht{aJfhѝ]=v6<\A&⨍nY!4:ts?k=Qn0@sŢ04<%7 "9W+pt4gG$ Xi|y¼Q"˭b..tߑXFܱQԟg86۷[=m8!;˒?yMQV }AIYBĄ&k[iW- #^Pa>Um^"Q'ď#A39r1 P\R} 'ď{s"4=߷+XlQ`o Z>84)I;Ż_[۝*?k\\xwOa|*o xrA)A쿏p+Eυx˘\$xssT)YaaH,8*{ƚ~^$a]l@>'ۧnb-H9Ӷ¥ƕ bEikǜH v'[w9·&}u$v>&לG'q+mN\k&ow*u;`ydסt~foa_Jp>؈tpɸh1dD?`Kku~6pJ8)ЖI6ě;:X8sRcɮV;_Kj>m3{n-Ƀ>"JB6{˧ ֽObDv*KbӘwa$5yaʵrY&]ױMOnrMX}''֫j6oߜ=uO{kGn5wV;kܝ?_:G5k]QWTm21 ܂oN % ?I?hah6sʑ蓘ݛK XhmrA/ZsBX=V*^Ko2{l>sMcMóZ[ŮˀDMT$᪕*Vچk{n6ڏd^_"~5XRBCm.{6>@q[h͌15.q2Ngspy{ǞZ$:Y{b-aǜ'O5Ҡcs0^edxi ~֣<؋Oz#f<+)y=k vpo0מ=ձF,Vo=-$[@RJl>q2Yż&Ok[_o# !_P>]R#F8-/cmmUZOiכ[1]1d5ǿ;AR:m{<,)&G./k[Qۘp}{}G.0f+8 =vhc,r;V'2ryo`ki#m{mJ*CZ tC:Z;;\[.9U$v##F>7AtsMPmokk  6937mGGVMtWb v77b>og9}P5ȼ!+n}|~$5˺5p?hܑxﰽoͨ\ ꪤ>ᥭbr28U+wv Ჴ+ш X"̌Dl-ϴ~gӧ C AV-u'S쵻;Ȏ5 X|9lO<|IMNiG>ǘUr{Ew)2hDq ]Pd﮶ۃZ`gyT ]YI$kcq2!nO|ꔎ(g#s sk-:mlXvǁ>V4Ԡ8\0l#i@w6C);ܸmgTRYwy1U2 vnۅ׺:5ic#0v|(+FykNs)Cm-rdmjuxi!XǞM1^rkpE>q$A#ޱm⢨"LDZ"11RՀ9D+Yn65 8Rr#w<וE,^D|^^$\GbF-JwrtV0ӂN|t׿;Ij?{q܀zmd*.an"] wn-JJ):{Ԩi䔣Եڒ>=X׷dQSL ֔| LK m\~s 9=m}V>Ե:* avCË@(J׈'V n16ӎT.&ISX57ݴ"Oǵ~h'XLv{Gbl4!mO']2W8x҅o08Qm0{{{H>#ԛm{_,Lsy|xy)g:ۤ8YX>췇BHm__c4h3ãMƮ@=>IJiw<@G{kvaT鱵ƚv=$DcC؂B<,^2pF109)|WBnߒ'B,)@O3J+;t[NIs4Ȃl^չ"ؑʴɝ0S%'ʑ\𸿏9I{< EwqnWQ&y9yW(k)vİm%:mmbok k}O .ƢNILp?O Af?_⒒ $d1.JCZ ݉Pl8=t…^T[v nߍDB&G^*V2&, J=mς8HDR]lw \YSY_M մ16ڶu̩RVn݇GΞs,K1kp`hoa!M{O`?1pJ<"b ՔCg?h[sĦ~˒b-hl0o Y惲gJj7M{I`)WpܣMďf2B xPUzy-; F7;@>[\i3h_,7Mmi1uR@<*m1oAVB$1nGȁQbH">_#HGï:rڭLțW5 b[~_fV :[,}d 6x$pǜ#Yaw-f;N ?q=ǚ NMTpf=/P#+FI WBnm̢exl6Xxo{t gƽDҰ;C YKEB u䧁$mib[EOgƵIǝMV0XHYX0"c>pa#l >߿Þb g@Ndٰ ǵh.Xơm} $F~\ʂy~t:4ZDUMﯺﭼ9-%hxng+D~g>e}ki{0rZIȦ DZk~U=~onaՁ<9a1xkGÙ/FX\~:sRI/.M: c^*3Dfk܅@MCƚt-%e~U@m~uy瘬RQ᥀|>=R6M|<{qNꝾx4]B] ߰& UVC{įkFiÌoQy2q9NKbT2"+bA|J,hS$م$\Ò7^Q~2OVןwEbd,lk}akGq{y y>,#yb5P XxiĪyB"g˥Tp{kc/̲o#ğBX 4 u$ 1:9B>(QƷ6|<&W+H/`X1]ۓ`vE/fiPE7oku۷_tk؏og&phb bdkN'}m++ dkx*k[] ?N`(s<YݍݺYWGeu~Tizp O3ٴi{GԁmMiU$koNoR *U56Ba?sY@m;{U&pvVԾSm0A!Yoo!8sϥ=3Qf]%XE_!,n@5M?>aFfnӨ  rWVTE7Wd&lwHo{>"g9: ܑk~tA\C16bKHO: -mm,9+v+N{}!bʠ>{;q*oʷq"ۿp#Mmno3;OAHJhH"75;Wq'MH$k['lN+NpM?QbMc@7"٧y5.*x7}{5aAÞ'WN8mYTXJb #k|l ,)>:_kD{ˠbCo@<-m&2F˚}'mF}yOT ¼@]ERـOgo|[m~_}:ϵ\aaoh'=U+fA澗9;X㓄S1Y7Gw?kxrC)沝@Z`Ƹ1R[tAK|y`# hB쵽Z׿~3đx\N5}7mQerbH}N|oz9pHܕ\`=vH 46?+#>}5GkNmuSٕ/ kOۯ4ROOh܌ fh|<9}~u`9]CpC*~z9Rx Ҫ\MtP"Eܟm>p5Yci{ݯ3H߷~nj&bk!2v)=?O0Ą Ӧ~w:Ҭ+"&{ Ӝrmۏj7"ñ VgG$k}HkNcWl7>:}|j}+fz*I ey{qe_p,v: -/߿<[[~$ry<"kt =<"D mϷƚ|$6m4>v[0}GOoxZYV(̂@n XE_=Ek p]c;UK*kC7+yrFPӐT㷁"W,O}մ:%jh-cq5ʛxM{yieZEQu Z =x^']3FI tԟg1ww7+j,BvqnO9JD*Icv{kF)>>@G/!:T+˨&<~5?p--蹿 iRq^$R_Aiye If IiiE 27ВtNs#Vb\| ]9`ga6ΆvFK1PncX].[{\9碷lk ,@He /b{{_+cb1C)P,Qs{G0d&Z_Ǜ4iĚ٘񭁶2U~x hj;Yr\~5&ڝAڄ؋D(݀כ5Gnv ۵BC7^lAEd&,$ ;q?O,bNkCwmMHP6Q=#k +ȣO:F$u%#F&22;!7ѠfhEVM)p,ao6u‘>[(PL֮ΓL!*Xowk{0DR`Ք@}>={ػGb5Gz+^ÙyT P4> Md׉*%tm}@E}?_,+t`bB mT`m1Xyg{ݴӿa#\\S#, oyM#*mZkPPǦJoQ@2 N(ފҺ>Z^MM${|w\hSS8 RCm!,t=:C.on߳۔䁯ٸ#A%7u=UBqsEb69:rXh5ntI%;.6䀶'm4 ץu~6lbm愊ڙmA;sQv$4NxvՅFy}NtSCÝnMk|jNΎx((e-wv k@vw}n0@ <Ǫ VOуg1LNH;cÏ"c:\\~ݹ˼mI*4#JkjXYM݃}5wZ$lCIW0󔭘0[$*8UU-,k0ڣob=tu2騽:M~ۅ2M=>>NC!'ovWe5MgmV$۝: )$gn㲡fF۪|If'q#HN3JB5_} yC;G4;To_ێ,u*y`ҐI=UP^17-dQ̶d Iʼn#poevoNݸ) ΤbOqS2Jm}X)]CjE0."wm'M$K_P~#Iy jՅ mN E1R.Ɩ6byv3hu gNs5OY%F(- B$$wmWO}*H]4B?@D>?:r@JNW]PaYdh@︝;siVMm_u5<4#ӟmxT(9؊I @>:wBnQO#K}f44 H X o O;I_d%h.;݅2/v{*ɍhݕ` aowAb<${mu{܏"Lb ! Vݶ>`x]Б<)1GRt_FPN<}ݏ41 *GC.됪A?32Y[uOS̴.c8c&v;܀|[,5:+!f'p6|F&̪B-rՈ½MUwW0:-s:}\)gegQjm`Axy@]<0ŮF瓆NATᶱڬ; l6FV1$ S@#lyDuyƶ k-M55SjA 6@G?}m?y¢;##n^iGm:Xxxo&+utU3noW+d,&@f୼oy={i7cYel,o9(Vo続s5aXKe'+f7>s*bĖcǚNEcuy0c{SvV?&Bn{>V?0lI=/}}A9(v,~\][9y\ez)K2 06@am{[oٓ|ypůX'[}kH"8װ)G kБm|mΜKт~48iٮ\?.(%Xu_0=I! 5'n߯nlš"jd[qK./\XrIóq] ndw5UO,m :k1JbTB _m׈]@ogQ%фFGiRvPce,{{G:q"Ģ+7}.-A8K҉L.lO}MsYmf$[m{A:[É>_.xV捕WkϘi77>=ڱ ƊMb $k\;,HbWA+oμea!wKn4l$6q{81nBOob0Jă5/e`m6 >>ܬAy ! IBt&&9P򣳐6o׿->Lk.Xl/w!B }FUXVvw3XܒN`_bdֈ'@]ēkױ(:9aZ)}kMMmnL͸nG>#Lq7ioDX!ʨƼL`k:B|ݡ[Q؍56n“_P$/k|;D{Ҽigeck顸98Ѣ7[NS^<$<67 )ۡpOW;@t\2A:c0~\ f[^羝9M$\1ixr:6cFb!5h׹:w?O9y['qn"y癭Et3 rߧηğUF '@ȻpF4#M67 0:Gv\^5Wn]ثP~=[sBU~yyxW_j WC:ۜgu)ߕq\ɍTE;oq-Imhp k ~`7;~:nvVɬ%]  =VYA )>7ܮ¬SJh]dY @h}ߐp /{۷ [de{uǻb{ydkVrlAwB6V"cx}omGYT#^W`tvcZۍq(dq  >,{n܇Pb@6&h7y~Ϝ*}7!CX hcя anłA1Nܢ>-s ;w=r8V\&Kss{5}kΰ.c*'w:h~U[LDAT0n,&<ܐ 5e0{I5:)@vV j M+ ycR媇/yqt:X瘞Ffgo 8T2]HEa{=9㐹k ܸO Brb ٬ ݬN]{xҝXMR,PmQ}9niNͺ7%ئ,N ^qhm;|OyfaSy"F%Ŏexi|B{\`-!>LЏyM=?#nIdse47} Q<+O$rQ hG ..=Ľbl%~}:_4]ʋcoi>=pkPa7Y  +s)1Z&j*(-ϸm&ڋ mW*nH>yZ^-kWأٯ`ydsɗ$Mi(X[7~cJ[K{4 xмך?-ϏgL#^'YLhj -[*DZM_ ڭ`ؓAnu`y!^@UDa8 5A~BS2$[ +dUNjd~a-T2I +!"G{[Y /ǏRR:o1V*/e{> ̡PH _BDPGɴuo }ݏ(S4SƓUV(~뛨ak;?) %{`mbdR:K"RI%Q͘#mۍ.go.A^joۖU\OI* hYt {݁,K1; 1h4in46Z'$q8˛;:_F=Ԟsк"ێ{kqȘ(LzpN01Zm,@+5ױiWTk0#xj va4Y. q+]85d]Ec,\5H:x|>Bd/r7Q/oݧ5Tq1>}ْ[n./n'kcNEFN~iD 7Hԅg&ͧIɜ)ሬ2fX. mO8T l_p{uџ`&hO-K cs#6&FǞQ* D*]F^EϏ 3 p֊־dž RCO7CbM‚;n#ӜJS><M4PZ01xVt 51) ;}_n;pĜxT?"pH}ߵȅot; .RH?z:i&NGOA^G=,IP{I:x]; ^Ud$}y諶 P}OphV-&$v-]yT`~"}B۠ӫFnvmt{ ð*j.H{oaÍGeLyt[5a3Îa=>N5,{FO8ZۘObhq>؀܏`q;\jUN4f\U1|MPianO>'^ D/q]m{yf;c;?JwV蔩@'Of:\ {}rĪ Xn{Ext91? k`âik5')P[p"H?}Z<5Lk: .N 0*c( }M:5Xݭl.=<8:Z5sͅN/*Se&ЎŝX ; Ng;{&~,zV:RBFB#jr:y>ڜ,lu>" G*?½:3Q{~V@I$\/N[ѓxRYmOr+f*؂`VXAߜJ(D,M|m5̓'yVyYDVI! *w\km"k('i 6m/(|:Hʥ$7}qď= u]~'0WHA(5)an}>6I&vixȍ>FxTJ"Xh6cog% CB)AN}: ?VuVycUN&2HXv [v0;$u[ģDbzgPYm[([iCܟ#hE[MoXXyo$ˍIiÜE,9XXi.۸O%msQP* >>?Ǟ%Pmsmy*5ʽ<)[&:8n/f?#~'bi~b|] nngD7lm8EPs󨒚wIQԎߒ6"ʶ@Ӽj7HAƺ_O~v,oeu8ڎ6զk41Qö\G)pÉ4Ɣ' mJTJ mkiɖd\m8$.Ckx+ qߒ)L<â_e Mg<}+i5d ^#ň?G'Í=yJTŖXZ{{~LXZ{OÉ\[c9<r&?uBZ*,/` /tkOF_aϏWP\uhV 'an#H<ݺ,駁6LNU4ܐV;}`Ekr+3]{w"~$y=緎O9XqX3k9k=oAV($xj9iWrY1M;[$.bouO>7 95)Ckԍs @4Xu8ET1^<ǚT}~U/,ݭenk2"=;coa: ѐXMkunxy?.H6^&ܑ$`A_Nd'sqX$/$Ӯap!;\'꿏{~\cwY . os7 Zn kqצ*1UvW@7$xqZ2Gktkvh*MzzEO8 :~n4C"eݗr۾ IJ n`|}8S׈E A]>s\*M>ߦUkD|u{>Ђ=konu4UY:.!/}{sӲ-=Z?>ܲQ?zkѠi,~[sUbO}MH?Gsڹkm^jESZƹ[\,o{x8$V`a=}*Nި5`ISh7X癢x5 vxҁx]lc{'ǑHh57z*YkCܒ=dTvnsO 0#p7R3~jC~>yp)k9_\x0G"]7?4yV! b5ntk$s =q:O=x|T6ǏUA謭nN~CsA\؛/ _gʚM!gM4o*Bco v ::da\R0$Ea؝MxM"˷߯)L¤["A[ ~?O;H`vi'r15uM" {rCQR>~5^#H#rݍ.3F.n;X\'+A5Dh"Øe!e :O<8H֪kQpYK?w~uo6uڃk˵ʃyeQ*R0YtX#!wj;Ö2xsfPoapOݵ"!bWC?qRFs}? ؑMr& k,MBG{s\Fw{'xpGek"ֹSÞ"EjHb8dAx=Ƕ~B/CHT .h0I$0Ow6f6njEQ[k#)]m/~bda&nxrRkT%OkwxHR=k4 sdӿoݯsw4\VR)7uOc{y{r1&Jg2*tB2>͜8Rf`q:UG坪 _Nv< _TR 9~bnff/xR4O!"}Y>TQo4 HT&Ăm}9FK@w/qt{Ԛ`K{w x[[m|ڃ{vSiH ;o9w^xs`$aw}Ƕ¤q!w^協v'ݹ(J/[y$߸~pwb$\_i&+b[Clht`tטtn{y碴LW#%ܦsg8[7m?ʊl}lZڏv`an载VkB`vӷ{9Remt7ߖX+6adU[?H=1AT&ǣjH< 646À1|; $TRf5}9)zKppUMs͡>oh9&j`+HBǷ;Ki'ܴ魃ěi s$hum.oo 5ꈠBdhi.tR׺$_ǛoFݤZ {m \'.䨶$a0ܻtۭ3W J&h,܀4?C-q刑϶Fk %]st6ӷ1$1>Mmob=>UPb E˒3 {h;#oRHV8ڤ c 絛}{9Z a7ػw_ݷmG<n]x+@q/ߛYՈØ=U!/mn51]rQSu8.E_k۝ {UP 1Xgp\)m} kk|~s b?x\Ie $:|I U]}:TVZtX_|MpƋA,O<.[nj|Kv!sv73HڂğydUf*ѳ{j nnaz:u:xkJ'uj4BVڤ oߐZUfXsܛ{H_0?w?SL2R7}1;X?aB˴{5_1߅7R"ڨKZ7"7[\UJ̦VXS l}~>3|4]ME-*iP6ăǜK/{Fʴ󣐶<[_~tA,6ѡ귳{zbi { :Eÿ<)VIE# *E=Ғw7=yA#㛎y窴kz*b7Qb|.{5Ӝ,Ď@?1}N%Um58f Zr#edYdp{kpo:-:}v5dM8.;H-ʻJ{t/>ZS'm'}4{x^^aw׹|Ej rHCkXXnXwnH(C:=Q^};xr|W5j$hU$nܯOA!m{_v/ƛ5L \{K{{_=X=?+;kA3+##_[C{jʨ1P^6f0"Kj=hQd>mI:kdsja{X>O0 V$n{xwmS~U6HZ Lvb,{A=Ye^Gn'ـfk'c`ŕ͍ě ,}/q:oD˴ELg t7Oo8p>ǛVR# ma:dw8P ]F2J36]}_;yb`NXlW #"lH oyڈصn&}#B2ChA kG J)GPFC^M~|;v`l7Fq۴U¢u.{N;8YuXU*'ןuTԠTTFvw(x;ט@F;i窛)ʆ5Zm ;Ms/mk_<9FKm)@; {;rRkmۍ>긎4Lpa$5#\^{\[A\ 2)ɮ*ʨζY s*6:ۖ6Ud`aG3)iXۍ ¡*SByڨ~`}r` ԥzШY'7w߭ҹ(Ekjd8Ǟ_qr-[tѤLY"/o׷73^#N\_9Y~*ְ7?jǿ{Σ^M@^"ZT5d%T* ÿ~{J"%nӚQ>v.Ҽm [oۘՖK$eK[wyk)SHAۿyC)MCcߕXS}*n|{empFc׷5N@@љPoP4%!f6X=;GME8{{v+sr`}Oo]{ Jлv'S}|4 i tO=3S<י%y RWm{{ڕ0C$:݅owS>40+{mog \^yQr|'֌ChǤ 0ʥocl?>S€$H, kh=+JcHy׵ܩ'dܭV3]hw sqHGa~淪R\ Y zpei1^8hek1#n@6MORM6wDG>UCIП ]coe>9yN\JA/3k߸6xr %}Sp,W22⻊'S㮠G*d\a;J't:xO;ufu :|9魑5LB3 ,*\2Qeڢ}`AyQ$yϲ\Ft[QOg"{r[n*ylv&G`ڑ}@x?Pß.xSfx]5OuO{s"7uaʀG<+ßmrҤǹӽv[Ml _Ml1aYXj a_ э簿h7㇯un@2"]ytkɯi# )#;T[Rڏe3V-o}daڐR8xjۮOtݾcYlӀIVuV {O3~]n-!kAnܦo*ÿ$$Vt=O1:b/isJUj|d=nqoqg02f=VQ6 *\m: xsJ_m~mO骓&*rZ$ʬsǷ< m߷EVpCl-{<͹Xmu6r1vE{#X0m0'[{YY6e1H,57Ǵ*.\wd*]pBu&mNpSyxÎs;Ybcߟ9$1r[ƴ.eX{k/bAICX =8RB#HA u=C2{C|#[_,5zk$4# l{\ZMqVF={/0mVv4B-eP܃ m~tEC;|<9`II_j]\ /1,[s*i;w8|@J;k߷"EY&yT4n; ^ۜXmtq Z["Mn;A${ؒm-ii$o~MyyX[uTxqW<AOP[UBd!,xxe77ǓJR(K˘8"(B{h̾$!Dۣ ٸ:n:F=?USʢbRf*7ڦĞİre/%K-{r dӑOD )Rw[eۭa-ȵ,__{ЫE)0Hj6v ivߌiM$ĝN/4ƄɱY)ڭ`j gUh-Qg -yj;pC},>O婳^GmR)&(I))n5$ 4: ~ke\RaJcYIJ0 ˀA~;"+F=D̪]}ᴝ }?$A>g҄q=CmQm79I!q@GLTQox ̏<.tm8@4UpIKLAPv{vU:v PRU*\ Xwc`M~\MNoao{;'y|kHNfn7?F^K-mkҠGp:9*d2G.y,F񹷴s orzkR#vy-o^bjgVS|3|]GM壘Y-{l/`Gߋ*M Ws k۷׭p6j>`m$?KiR =7|{-\:;b)4*M$61m+~50ۭ*XdBS2T5{5Q⣻h<8x\B,@7/;-QKߍy*hNەh=4;R=%K}r]@XuCf4hթ` 0[Zk56#poؓ ġ@3ϻ=ơm>OYk``$[ݭO*eءkw߇H1շX0JYCj&e<˹6=\{JySX$H36{=9V13P0uVzkIM {bH'Qp%mqcsJɩB$Stp@ Zý02) XriljՉυVxVDG$޷"ĐhյAuxڅ4oLѰmo~-D~c;Gg-r/ַ WOU=N5ʚS$R]h(t7>Fz'mѥ o8Nt8}3SJM(- m{_FO9Ӭ]Ԯ>o. mHYڛdq+VkOĢ$6n>M@w);y?.瑋V'jJyO,đZc3NvJ5K7\⤍/ 4JdKY>Gs ^<xgf]rom~7*6 P|ESxQ8!T\hC\+0}cq] k͘O>uy8aMP{i:#'W?tyyX-5}CK% @owӍ?T~Hit ᥏l/$n/m=^'WgƔW5q-~ B[hgm(A1| 1d-Xm9w'?n$&id)V}ndGFdm \|tH VĜMchYVBm$Mo3"6p{ƏM8 V7ye",u i}÷hSG i4,; .u%Mo܏h][XyEuU Smnmo`6yb%-PySNyVJ^Ņ^ù&[Oo3@pn{>0Å^yp fVA#N92p.|5( "l{m k{l9MA9"I"27s; Y7QuO[0]RKw9v=ݥ wύ8W+g>c x{-ne!"* icrm6$z9^&Ē,ָh>5/q;Vl[v-?z'yHwp|~לHei: 6!ylG<^8c]!BQk >?G98?=q&9? .2cru 5 }ӛ #yӡ@kItHӷ26T`-`Tlg֠13PZ2Jh4>9gН͔uoTʆ%T~cyq䡰!/mO~n 1X⍚S{,H{-ߝn6P79ȊY{'{6jt7G>Uͺy@$k?l0n õRdM[ʢ&|mQMzJqZFd'B #NӜ7d -I\einBj6q3ږw  [dgr  j#NsQЬws\k`îԅy;۹o:2D\x^'b+NfF/ο%w=XW! nroT \|7"^מ qW8Lo}]+X]F7( ,/۸lM^xVFmrEv0YQsB@$Tw_1ײΗ%DxH}7;v/餒y3򫚎85`< >W#4ڐ/b-c48ʠRHrnZMooLTͺÞ gWh5OhkPtrJ)w }amu7f81*kЂ/onRB+Nbotכ ~~]#8O*QKk9GOeUO&qYT,FX:\96U$~N}l}jnr 7!xs6[qr~lXJBu#]-q 8I) n'l=omTmrlR;x̊<ꠟ{Z*C}{9"jK^;Z(m_ǞW1k8f@I>$Hi^_{~|&HTKw鿈@+MZ}EƂx?ZV)$jJ@b,~nW;n[ jmrf co3l%MʟW?!I$W+p8yE\wEx5-I&B>:;>~5S\ ET'l@V:2׏IrVXYRn6Nݿg:ug1|t=nl ʿnƶ_LQ\Չ }.m~'ҽ +"i.H7=nps}ͷ->T5$CB~2[vNv0fU}]=F$(UVPI^_O~rp#nI6 \ ʏU+[$~W9,!MoqrEkZBTYU\~<+u-~v;p5}k(Rn$ AGwu:N6:{ hbPN|r P']{X#NځXXY}>?綧n hOsšgz"@v"}~65hщp|mԑ~8j'bJۂ u:;j;}-*fQW쁫_A[mWȽ>XjDžaOpobi=<o*7ylirB,|oy [[oqbr#X/;ߘ؇w4:En$ƅA ItA }橝 YᘀH wlj7m#C“DFV} Ƣ"y`#iny6=;s\*k敩|hg0HY}}۸kx{9p9ڬW*W$0Eň6K.`uSk_U:Hi™ub@{kי }a`mÞ4PE$:ږ6ԑ{Cv|; yS\ZZ82_[]#P;)͆<r/kc8"ivi{~) RLLuU,K7H.<ØeF_tw}%p4Vʪb)Lm[ĭ EM#{{[AxM>Mn)Q"Hf쭵Noyov*#fI'>TU<2ۮ8䱝$m` 0'R؁ky˧#k)FI. V?ȜHUЏqMeojx4G)<Rgؐ=%Fr #yǖӧ7W%FebPqB>󣂢yX3\!pѠb{orO0Y\0Mƽrqs7\)!-5b;@9,,Cv$v>>>1~?rU vkF.xz icK%X䪇ԨCcr>%lFֽTZG)1PNSߍt|81*$O$EeeؒHNdma} pHӿp 9癪[ȷ-OpeVn<@ϝPPWi]d6:\ir>Ks,.07o?JA8pV,)d Sy7ߓ:"{x>uCQ$Rŏcm~Qd]N4tW%f(΂Ξ) ;lBkbǷ6mn:kiA5'K[9W0t݉qRRU϶U5յ<4ꤛ~Qm)+seⰈǞyƚ=4LJ$߰ &1E)2~SrX) d>C~ےֲ'[; k[`-6I^Ieݿnۜ E+bxg5Fχ8צ6%eު&"Q8Kk}{|l4ħNk$i{ l&,G{[晴#Έv6b{QpqߛHyᶵ e1ʄ"4 mmaO#H<F6=oNqOc!"7oSiÞxQ1&RXMoFi@ԋ 4?.XFyE]J[f*Rt;h<=R p5妙ef|$l%rO!|o\HSeB;u\v2UĿWa~ǎ]k2s5k5oϜ6}cp Ν9I]/q}}i Xx\|05*< Hŗ_vgc%Xi^\2SU*T,;Ø~Rln~:1W3G $R2,ud6*7JnRo|mΐ0)r/oɯ734lb-sr$+YXt'I_/pR@7nmns"Kt',ou9X\(aES`?84AA_۩Ml4fAݠvV-X߹nzy3HJqRtk-؍P}Gw1ND|֣F* cksƬT u#kjI ̦1IrHk ymR] |uݹYߗնWxw:/B魯$cq}]~? 4EXpVi䙝A-}NhEj4$\w^W[ v @Л]i-vu'juA ].Y}rH7xiatit ,-R̩[7o# ?6ֶ7?/:3y?@}ug?ҭ5yc@P{oq!N= t9:U> )"A6<&1÷$b'msKu'{NP? 8?7j{@<)b@A&$8VO Mk˭7&IF+h4SA3V]!S{j~P;x"*bH"[n2NDMR$*AQp~ծMJ9*t줍uwFQQֽjM A0X#n`-rt~hNNѥ{A@>߫q=/b)$}i6J>+I)70;4<}`v&-qۆʁ=8#ST@28,/ /¢/~v񽤑ZO$QU{~'3-ԛ`}c#fFc}r9{!u[Z<{o\>I1輘@*Aip<<^4^wӀYmKE{veR{[$lSu7=;?F*wʤV8WsV~E8X_e\clL#c[yH6j.;ahIߵEp ^7`-u7Ljo0 'AOzgJ 7- EnyɘإK-߭h|j\Kk[h2oObFהZ\4Q]@ǘ$,LJǗhMIj{74{[ޱmReVfrH׹$YEؿIog2;uc5vcVJd|+TdO*|w|1 :u>;U$s>tԙ >Ԁ{|y"ƾZpt׶:rI>Uެ.~ױ?Jbj‘7:le(D+čm>'#&Kb6 :\W,?_o? ,[^;A-yִo>}\~1wi6Ǒ1-Ih6`o`l#{kq͜6s[1S\O0PRu|rȑ"YHSr4ll9 C Ok\rF5MYK1d l.4?,v@]m{~kLUԤs利ɵŁ׷srV۔x xrW矍vڬ5D3>~sxsWN;k EenwsͲhF?Or#yƬ1]+6v=料=[HKmÿorMPgtk#rxs$l͠{yy#e\t)%rZ`@+L?(YYAbA:''1j'gZppG=gip{_A<9{> wNxZw0;AX\v{Y#[3(E[ӗ}Qf5mG7G8!Z xf6BpVS[[Aw9X cf4vV f$kwOo:rb{oݽɌ*kCF<:_׷mtG!PE?j1? Xr ~6y׏s >}C| U^bďi灊\֧[5}LQcةbEp+l kxtW^dZg~O9[uٽ?= r5k8tkJC}-{j?8#@n­C (1-Q@>>1g=߀' W;;xw8v$@5ixӆx LLdRII;D{́so:EVkoۑP2nXUs3Yi%b>{tDc?E|x蘁 ]VX ܍ol5'ǎ-V +M%)X\=Y  kn2P#kW+NR &mҭ: {h '碓.1JCKr/w[=5\HaQqt41ƗX5)T2([ -fݹ_ / ܑ~cIP .İvQƛ@nj9X&KErz+ʳG;"Mr:ma}-xMUa?q78tSqI\{DXU}j~и:!+b{Zv2'~T%*(e^tg8OVe4bN{ *Z1;JY$rYA`nx=Ld4n {G=\EIjg][z&vҼ Euh^TR`$VKxU{~+3]Z{vӾ$A`orJw8,p ؑ_cߗ* ϜS&Ls] Q2{}vF 7-qpH1Aw7}<=i%BF^TWYP6ib5}k8 j6d.0q睕$2t'MFjiQ@@${|5&3Ɯ02pyVDgziß~EHNW?/7UƔH鮚־{؀4xOǏL|2Q8َ}.zF*Ė#X{=/kgLm<8~5&MӼbZ%ܮxiaFLǎ=itpc°=A![$!x\yFnNw+u g;*kGAatf:؎{~dIN-aO yazu۵H /^v.,voǔ\9κWXRhŽ`^Yvt ,< 9($uq;k4řqGO X߷ߧi<̓p*ye) sf:Qex=~^ ư;}r/㥏$ɦbܬ<ڧoMl9fs[u_[ˍ[;?:*mB m}< 2_a#(E9r*=@XǾ.. _B dn4 }V2u:GҸKHv|? Ek{l-}5@Lӈds #pmt{sU-)* =<-8O?g1Qߧ#daf* :~HTN*,jeڡnbk_7.)b{X?ɭNt-@t` K{}I ? R&X~䁦Xr;RGmt.E<^Z+g[Xc9  5Ӕ*V8N0c|ufGi2o`o+HumqጝPI#8(yL?M:4Tn鮇A<5iqwD]Ahr!@$cǤ IIE_4LƪY,{o`|9Z -`-`兑I`c-^fel1݅:!s}tేV)2 I?:w?*hdZ{V"DՒpF} ۴I)x^dۯkʔty*cc樳{l~{7$gRGYS6*/horG;s] b :eȾ[Ckyy;>0Xb}<;eiXb d܏x)h;y2]sk>sƛ}9UNi'} uXwIb=nַqP(mE(>,O5)KaH:+Y;rmsaӌ y"W5F̜#m pQ:}Wǒ`-r~'@Ȟ~:"CrCHB8ch͸r8)?>m%%[Q$"I`=O{x}OWE=OuHD$,.{k>qcR~ځݸ3¤Mn&&[|95R,Mw>'0v1'݇=5 = H7`m؝5&ݹ e &B>ڰzDX7Mw`_גMƝq<,ط/{/g<%o!Q)S2PЍ>''>:?lvՅe5ƪ-$~g37 \\5$Y۴{- Xi}>$'42ԁpO{Yb1N}DFCfbEg%iiox15¢ !duG11Uo_ }'DIGWMA@[[7#YFAq}G61Ƶ3Y !<Փg~x܌HƔjQ*U\$v 1$l5qqAO\w>?^Jc k}"vNIKܑ |-Tz+g[%C?ng}C(׿ǵ·Tu_Qc/3J3 >v&F5UMwwu[O̊cY}.{/4A"ϿZQmmЍ;}= #u[myGٽǞ(C6_k;y$U#^gBnItGX5Q{hƯt}Ld ooKs,w0/4Ǜ׈]I!1mp?i6s2 u#xz~THMe3c&v~quŁ><_j+X8tqo;G `^$I瞊@X|/o$D"ۘ=njmzE6cmXxm"dn4ه=USYTI"H`;߱"ѴD)6IbB!V*76OdtW :XyYNa}Üw]!MǟV+,׽(2Dm{m{n ®#wwҦ@vQ2FA`ӠRzGjƹcpu?[s3 ,p>t?oخ5_O~E&5 𶠓}-x1?VAeU]۴ K06XJNxr9]ǝGYC{7Ug\l##,/cm9֪5Eѵu_:_:Y )7o>BWnݻiȍ8)EsXw {%(sq IR\ف$ByKCxc͜9U;N~5.ֹx[|>q`v< d ܃IbP˨WhV&Bǐ﮿G'->{s1U"8`ΪFoa_s1E'ak۽lEr[nvlu}8ցOخ%F[̐r>P쭤u1F cswuGyF;yαh _i.d[t7В>}_w4OGOL,i>{2+H vjaLv#/DqȉR>6&;e61rG*,{vs8 7ot|ͶߕOodtN[@2{`|O dWU@@7^O}&UȚiR4>u5~gcXPMNWk軀$/{(Q}M{~[i}n Wu,.4"xw2 uM@tqXC$FVb^sͪX @x]e#rM[sh6 EkisOp` x0"Iߍ(|J7ŵl oҴϧ^4LA4x=;ь!W,,~O"]\jO}- x+uo>Zg@p[U6נ9̐7Հ7ؑ۔ʤ]4؂Эql+ָO*F5 ǒ4:Xk{|{{Cf۲y0 {G>툿s7Z?]G<F5ݹwb2xX{ # NƲ4+\@,U6O0 #a`<ǗT;bI#>O:)5 nhwm;s*;t?n ׌=dzrcLz?OTYō<FFl\s~:G6^ÀH&QP8򙃣XMtn]U%3;)1Tyo @d÷ÐbA$\(o޿n8xRBBLsk#ISb6~~<%ckurm`*m> zvt?9X4beF F׷ Ʃ +缾)m#2!IkƧHcžj_iݏk{( `A6'M?`}9´jCA;1.akAmߣY<iC'z+cʻWO[ح m>:s;aZVd Blw/ץ(y4__@>Ra=^}rPr,E9teĖ;-9y'U\aMcfi=u9$7<?*aby";ۿk~** وjx${g<*5]C[lu$ņö>}yyMB "ydDMܝ߻_{]pyc)^"k۽ [\-1?RUUib%7?۝$X 8SmZH6SAHĂ.540Qj%yT n?=rc)M].mwZda駍N#~bh.V BeeP@vjֽ܁ە~\jG\ŋ>{~\aa`5<8tsT9w7C{ب koe}i.U*+uy潀{B N}*1Tȝ,nop+(H'rZՍ91v$*׽i SP]>ǔ;k_v"ԾKƷ.*S{yooaJӅ0#T*V=Yt6~a-η6Ѵ7OnXHI빔 `q>o#I}#~(µ XvPՁۯ8Y@=?ǖ\>bsb 2kjs nbn6j8ҶF6h},Ic؛>\rje/{x9%;v|jZ@ R jo{ǘP єZOo[8^ɺ:,ʼn6 dzG0,NH{~y]fتI#{w[[[Ågm~QJM1#S{q: ԁ[) ≿?>:6WjwxN2Z}jZ${~w=`wx]/A'I›x<!JuuW {Kx^Vq Ӱ%ڍq .HԞ9Z5e z=D<F_iSb9WO/T[g#ʡR<Iua}ӿ1enRg L6ӵRʨG%1HlqkZ٧ǓT=0yXw:~vJhH|n~溸+*A%he`;wvC;]~b)l'omd{7: ( 9:.`wʃxt϶|́Ħݻ?_`9 m ߵǷG=<³3F!wqĝnH؎ I4ѝIy)@U#kMocBxM{}>?g,jytMc)Hvݷ}5a>U핇lL)ܱC;WDڻM`PMirUN5ܜ&׍[^kwӰו3>{dB2+_$k{0̲DVO!~qGXJL"{n#_+j{sNMԍֵ7:vpž+4a%e tװ]2ɳi7TxvBis}tKw>uz0ÞyZwdqpm~\ >>۞8r*q nIg[;{yO}Nsc}-}ܹ+Ё03t Bp-s(6H$H񹑶̨w.m-$؛":Q'H]wZ?f"݈ncU'?x9U+:q`$,l uT`2}|lو@\ Z"}|{s1XF7 /r?[&=ݨoT@@>=xG>ʹD){!H8VՈ5#Ƅ I6$\xcȭ:;Ug\e ]H]/ W@{z'՟UyFjaEqA*@#_ >#Muڎ Ƀa\֯O blofœ@G~\ LTmɾ]Mo`'<9~׶{v׸m#3ZUhU]E s  ~/sXp5kuPusR{=s*RQX1c;x.]yŅ&h}_o7G3r)xdP ik܁&fMX3jW|4~ch(E! _`'gґ\ /NJݣP-oqHrFf(lFty͏4FvZַXdpnQG~jX'8F35u%m.R?ů}=䑄ڣvw:+q& +[#Q~rt~&?g70'u9+ , Kba;2IoO֎]JXX Ϸ=[zIb5iw#:[ׅH*ݮ{Ѕe}to<< $_ e-'Kw9BZNJAX"{]{{9U M'[xsµ~\䶄kÜŅ3[Ep(ɋ Oso0i@ڀV_9aiqVrK,@6% m7Rhu$qMw(PΧp[}@D WF\I~\i NO^Y* їo'!1N־ʌ=Mw8DD{79vϭSVUU0(w49,ߣ Xbړ{q0kז;m ``cW5cX]H`.=i|yV  /bH r"0Yc{޸=Awn4xsN^dw}ʐM; YY>Зf'A&ztS1S)%~ѸT&>_Sp@=UH#hy^oim`c [M}<9qUT8*Zt&re}[j; k<#PlM{w9\lۭq)< ۸{yք;k n "*\s$_Pym_f {O77j97pXio4ӏH5| NͭG*`}[R<,>M_aIe:[[_9̀2ġl|/L?i5T<-n,z{><:i.v iݸ5NĨ T#NkO~pR@ ͍`'mi#uVDړ a^xz\V>f[ Sk,J*'~/CiDn`4eM,:cє_t~rE{hK.V۷b Hxx6{~W,LfHwumǍ.rHJ=M}=r9jgξ*mSuIeUth6nx#jmm A>#.sb|F;I϶Mf͵ \=WZ pXU[V?UՈio̞^ 8~5RI8sƳD`JvAo.X~)[v}m|3))qFR <=bA oߔ5I瘬{Q{weGdnt$_+aa{ =yc \NP6sl\YU  :F1[@ZkS52*e"wx5/X1 v^r8OTTł#vPn w^BY6nito1;9ricSJ n]6>xqV n jmo }ƞ _0*8bW]rtnqi8w{sa1TWM{fё؟r9aZcG<Ԛ!Uѷ{_ er<^i|ΊotjE:Ǎe1GܝH6>ꠧ$XB~ѭm[q s;Gvݨ=>\*P5m.-xɮ0TA4(tBw1ݗu"yƮ JJHSbܩmk ts"eӸϏǕ+cW-B Ѐt\(IK^(V㦦De$w>9}w6S&Haq/sR*c6b繲l?nc*N v<W&bDueB\_[jyHt[׍[":*{u^CbnOZ+Irwm^"i:$2!O?-uuC)c88Ɣt8g6u7^__g>aʞ[o7Q귾ouIE1|ךۥPֽuyT*|4t%,C:uQݬ dWK[>x㩥ujeuc 66V ƌ z)*EX"" {{65oSA㵈 ߽ǰƔƄ?Ihrurhfw5"4YVxfXzE<}Vҫ+6=@7aN(;Â/xvPȦBu] +`Mp+KioמeEk.u" sZêD;Rkv@'_gǝlƷԐ{\5=< A@K nmnU~ %=)wyi|k™*Hd@&QA㶾7MvS&f1hHw2.@,~{_~ jsƷ˜j,./`tSLeH>獙lß֛q\S "7p^s$Gm'h;Z{T\{ny4u*@؛[[K|yӼҬ鵆5;[r:sZaUmuQl/yX%&N)JRU 5&9]{mhoΕGjW׸>:8*1]),b<.)YgFy\aϠ4  M=(i+(eV o%]Zŀ;oax~ڧm 8|}qk-’7Z_ٯkhTv66kU2<6/|C.. }=Önn4e*+ Qfq Y `^ߞ#Skj`>uGn6n=>P*|*DQEVk~%u7q鶚8uOunXPw׷$UDe6&;^ݯSƝ8aQ73K$r-p $Òr2v~;xFLS0g(v0hǰv{X{ؓv5 8Щs+n. S^jn6υϧ>yQ^$SPܬ@>ix#K{>$|8Ne' -CJ0A_{~' iȲB^am;b@cݸH&ֹJW}Ls f{(qm[M{T pm鬡Q?kě(ko+G> 8ҰyS$lbmNl򄖦m&٧TbkTB, W>:,9n 4ڋ[B}tN8=0^ MV8BvD!{|xWK\[|FpkjP@}()5WHY̬YO{ߵU3?Q=4M5HUM ? /ɦia+O_M˅J*Mk駡9 S؎cQÍUS,@EˬbAZ98 +Fg71?j }";Œ8} Ij Dr2Imu'O-K9~GO*O8Q9-pPy"=\W@?k}[QTZZ4 ZI'e*2ET8x %c-DEISm}jItwyM 2`,&XR;OWƔ- gÆ^=<Z\D MZ_rߵǍ[k犡ju }^ u6RrUyQ)ablvÜ*sM5 }v? S*$ 5.,Oj,{;F6Cߎ%2`Jχ+$V1!_Ñ#bWV2:x@?Q3*;9 $ںZp[&7:\{kBdFQI-k"P^d&kar;(̭eͥtm^9ʡSIs!;@`->7xi}y<)/*T=%'f: rkyuŢ-rیi6TUYhB3E ba{QA虊/pm:isKQ86sUiU%+7WXo: >7 W[{~SQX͇a~w㷝X Ϸ* h>Gr;knsH`[MTyxW"פ1̰*cap4m2oF̀6:q?^qΣ;wG2hWX Ϸ'}l/o=U(У=~BO׿&Q*۬Honq:HH<+ k2n4x|OɊ-&O*3۳~5HU)@sfv,}Em*)ܴR,ݽɉ !{u#xJ uTriReږ8?O H&koe;ƚB`#կ}۷&G,`o`mxRQښ3gfF"vKt9IǟY|+M+*}jߒ.qNvSs$TZ/̊*ug^ݟ5ii rHh:w#E] 1OƣRE]EX{ N%oi@`PU'H462!(.Eە) *4I±>}OǙYV#rRV/׶6G~v?*ha]O 3C(> >c$47mV x8 ҭkFLlmQc`P?k]m۰¬II,*߱rY,ѽx9B8t$Q吨,@"^M;sE5pBLQ* ;A9?ߎǷ5 ny.t9̕D ~nOǔS{k{iᦟstv>6ǰ"HޢgWb}>$-9 Lu @u-ue|yԇ`-kw:h-mUU+IfQcA}IhC6PONæ `Nt~p6#Z(_踷j.s_xUY'f A|9Y(pEϷo q:+ڦkTeW nKh=¦8;X, >_1U3Ͼ "cn_󠑰Ԓ#xls.ҁ[쑧ĺ:& -ӑٶ{vqSHA Und*p-c 7bZExȞ:cS_]{ r;Jkmkw=/o3ximl5~<93;kFޖ nO?㑋A{ e'F*.uV[cHPâ\4rt 4H'}|i[+im%o܏jH`uԅSc5X @BaǜH jI6OÔUMwMcx(V, #O-kH6ŁP||s]OөO<5I!b})oXOaX]$ؽō_^v@ k܁~ք7Xs}En{k_H#Ϟ zM®f|)$i};hƮHN/Qck^\O;2_ jFO`ӷd*Yp͸$ Ξ#po>|{`Ei(~u`V@&GE@vDȫecbn^mOj<,>>l ǩ¥i,v?݉$k܀[ОݭcnPA$ ;?FY|"sV`W)*"2y*p.說o16}+g?*ƃKxnы?~`mmNk[GMyѼ}A67kz Ћw9yu=5s@ ,L65_T@^|-}9μU:QRK؂5Btxn_khmcquUdRF[Abo t#Pmq}?hO )o|7k5t$Eٵ߽Mby[XEH+ f#h']=9V=(K!ztR?o21~ws nXX~$J.i{~ߛ:V*FH }s J߾_OGz9JTx֦a,vi칿ǝ Pww'O iNӝuF=oGkt:)-ˎZƞT 7{Xs= {MVD(f7;1K(#^g4qѺ{KAG $'Ί.yQ?Ubq7’ m{h-wpnR;SS A}džnAӎ%+Vf)P}u˙ ^Z^ϷymZjh@}}ly)Af{fShAu;F~}\o:~WZX&@ e|4pۻމ콇ty睕y*5 *h: =,/>e̫rHudW "FI,X ׷Z&9+2ipn-[Ǚ,ײ* /coh׍:ƲFobF׵}ly, ?9V* CX("ֵluF ͽ|52kqi1ck`K)o>Ƣ*%[i|=҉kbFk\ (HmI:\\FE,{>ٳʚ*Ӆ9-[;S[@H[_?G,q PbT3"pX.?mLj}:#ceaO& {pX'S_VWQF$U؊Jf2DamlU2 :}|2l/6{~TX8hiB%xo;吏uhPBIk㮖:iμ$ݮGqsdc5Mp8R5 _Np2NwΗ2:"sX͵=ٯn!׷aߖ<efjU`ů}Fsu *Jz(Dv@ ۾/3mk_O<ŒnGi+Q) {n@b|A<$L)#[ /߷@1e0L=dFgHP7?s=Km$w?ƞqz8M"SKXItb:?"O> czՎHVI 7 JY"7|4⹯*G;)S@GFHQ˰}^WqQ?Þz+O/x/`un>%Hmijsa<`܊Tϯ5ǟ>^lR @*lI("4; =e8s=5|OlƶHʧFK_A{H÷<8zfx2eSbB=۝u~#&hHFmG_F- liSЮ7O4TA=ۏ'DePK?AA$B TWwKX>w9#Gy3 47~*‘>|iGng8fU(ZD{=wquKYiI@񠝳+Xڨr. ڏZ\}*P0n"Emgn  ILK 4MvIsO:`A'~U>U0,Bw}@~7~`Nsk>>:qh>u7 =(LL.QxK%_iӾRE>4qF4X>rm _OmQU6 u$ot&2PFCȲR7[;SǦ׈O9a Y]K,yŬF76_SE+Zx zr^\3w[TX"`p,<ǭ[eg!V୬@t2 [_h׷ϭi(8uTpLbo{{\~U o$(SF?D,bXnr;`,t~_TMjM+1,t[w?gʥ=؋}牌+DMbkGP IHk1 __g8Lw6$׿}NO=jFJmMWl ۶Xoehj-!̄΃_$;}#A؊ni`dU,]hIwM9f ~\͔ڥȷtU6{\n2C#`TI uK(5N"mu%@#GNsו8V0&EKYIF|yWYa7^ ykx$sĠ7ð 46;lF&ӷDmpz9 \ ;OZob{[KT0J]A̯˳`vtO*)بj:þ)P;/NOnX91X7ks!MHP.O{v6> rO˟j8TԧS+G#!"@#_cH oI/IǞ}/ƀ .?{Qߙd [uѯ(T&-u&Κy\k&']/_s )&CʊnXhO9,-rݱj~+Þy譤k~U 5Ù &Ӗ)c G[kH@oW;*4 <\jKI^,l4wKn sE3Hbf!C mV }')p'kjA^"jCE FB. vҹ Սm{x~\m5\"?xI( ؑ{_ҋ+ 5;)͘m$1 E.EiXZk<9Bi&, ڣ/!!{im~~A0$=!HQ`=57?IyaB*pam';EpLD4%t=M˰A(,6^k ЗP3oЀ.|>"$hǮ/T4K3a1m [_X8?֓X\lo}=0tްZTv[Av+-xbE:owqpFy:0_fPຂNa}}orFz+tH;O'~|ǶvaFGoθF$n'Qk:̠6;¶xTG16浕nkioϝA; x-kw59+%3ZFw#Xn;DqTۨ [BOx 8z~U\UAuOhÜI;V7oߍSgpF>P- ["׷`<9AYe.mngoL>a4f}6P㏸7 @PN _ <&ִ0ov 6S~Dйcnͽ\衕@{47ߚ )*IgcwYn4?G89S}ox}kg%97>߯*{1]Ni6ƲTU BHk>pv*HTH?k}r l*8HZ6;s׈_k87eP5f6Ǽ@=u[Zۯðǜxݏcoo{}m)*Unh}>d*,.OoOlV0kTQpE6ml0^M7tUX+) 'm735'[͔걨Ay _=o&]i5x{}\OG?h*+'6bEɾmO~q7^k<9SjY#Imۻ pO)޻а[꫌j<.ٱG=&닒>>v[*J, =QcXżmmɿ򄙑<쭧\$Q xzrm>;Ǟ|`)Lr:8 nxZ;$x[4ﯳ$G6wϯ8Uq6wkaνx[ċcyns=u,Tks~7@oEX+-"fr:wv5h1 kp69eA MǶ׷9Ȇ Ea㮷WUß: v`u{*k?O}>qU@Ԇ7$}4DӞ+ -G`oߞ1] ׿5|pV Z߳)8@e6?[ʴ5ݦK G,{ WCs~\tcVykh 4P {ǽ̱ܽ=rFs订66NpFHo񶼴Mxk| tOg3@#K|><\aYMln<fqk~58ϝVPnmm=_e.Kk,imk$l"M~>ϣȥHu.wO&zjld{XCOӦoua~ݾ:cSQM>דne7[MSx)[qKy* 9=6}Eb^6~*:k-jMMuu׷̃lw.nt'n#y݋(Ո:v@ JF˪En:1|o|C~uS%+;!Wum-oTC({5Qmϳ 禒X',^O{xVn2 ;ge&g +^Y"[5ױ=ߌ5bA[,qÍN yWwovtT|{\g M$Rď6>pZ"Gv׷OSc=$P/htmnSbmnGotȮ>}-@{O5 E͆~'j@ϟse NO#J#XYu[qZqc["&9S|fUeZo/{wFX}2Rla)~=T-@0mU}Ҿ98n/_'~Uq(˦oz?h$>F#OJ Z\{l7}|\~#O/ƨ8W:-F>Rii`B.H|Eۿ VHc}=8I<5j Ito5OM(iceKxm'>R)ĎqS0?.E.K3~?cav`5ܝӷ}Dm|,;W'L0I_ҌAS7Èf\RU"CFwr]:e*6c+m7wO˘frkksTsқ)O0V,Xn_yTFb~gOe6DԘg.I 6:v}?dYL6kS{.: 6sϝ2>wOyo$h{yi0KPi*̬FxG8U$R+)zO>Ye,KV<51j J*jhfv:5: _(Keܫ0u$Orj*D2QXjxhp|F U*du ;nHaqynP<}'Uض]QzYp jyѣ UoA_~Rv+UP٨E[v޺ x-dl QNuRnH*TB`] qQͅUI ڛuyv'*(34 ~[e ʤx6s'-ez:"&b,;}+2~􀳀Al6txAxcWA=Y7&6Пors *&(v,7x{/߀i4XBY@n|8|x|]\|bzEd MXC*8xmQnjmpïUIT C=8c/˭#õ"$n6vʼneaVRSGN" 9_p56y";uOI#c={͹D@m$hrt# Ibds_ ;stUgy2U-{iK,?ty!A#RYvMیO=5Z>%tٱ[-C/!kuq szJ?XTif}w5G.'s>u4{Qpv Y#7*wo. o{lyP$a=`""-$@EGe&ďa@rE}@"G2=\S3͘Ŏòe,.Qrp( { G{{8)LFcl%GK2ف\~=_n~xq&I' =޵ơM`U[KikssnЀk2lsx`>SCdrT8}bl;ɋOy5Oj{#0f8R_eknκ#ߠ$v7$_$?'ZorNwƬ)?*FH6ɶϰu7o0X8D( zfLY(qmyA1 ,u#Ƹ|~WƱNѤYݸ: ?3sD!{ Ɩu+]M9yl`amH6"{yP4g;kSP5]Pj^O9.lG G\v㳦:җ٘lH>n#|g+fy&HLohSk=}|ʲ:R{۷ୃw^6sT9i_xȷ_9Dܗ _*Ai^dTT۸"דuok)Ɯk`G rt;{=Ht섕l<>NGT dQ}KE2F{ӳyp6tV) C6!Zk|?^qY#EPE/wJtzs5k td ZFHq1T=ǰ3d[;[Scg>kUdq$""뮽kʜemP VB{. \{HΫeH#ocx[>_:Ax8Oؒt:sj'}R"+q#]If7 c?np{ۗJp>^۴%}{s(>T$`}}Iƶ>UPbf2]p|,6m]}|xvSzbڰ}Or~ 9!R[$JaQܶb/ߜdӸs`Gvm &wn|~29 hMdu7=4~| H?-?=5z,BO{^WZE${=ȦɮrlTOqwǕz篅Gfv$߸#ñY9 ak'ßҬ 5Ōp̪}^G9ɠЋ7?5s8PxlerYDn@$crHU*C؍.*3[k1x92 7<ym @ 6?Vld M÷;6+cӍq ǰ- t CGt|999譔v (+p=/ rua{c XDht{9N_O߷+${$@ֵ؋ :"6ltn鉦DF}cmO$K`@[$񯺟مc6hof$l|iXsrV׷O]{ι)h偼[1#M~骁y1-}k|9!7r;[8ث l}>ߜc#p#=ڍ7L"q ɸ &M>9HIJƻV*Z_mEԸ;w^Uu@f}L(mɰ!K'߿T|M?e54hf) mUVqȠ3,|t$} +Xd6]Ec=6!$lk@o~xd~5uaQo5c7po};<5I=ͭukk_M?RE8|[*WL:hٚpb;[MQ{dURk##K!vc{4$ZZ ߵs-8t":x^ VTİ 2a׹?ÿ9{KrմQX[M/om#rZ}:T9 wHO` ^}U<"*T2͊2.9@Zlj~7ƵAßLk`Y>vgQK,q"h;h@ۿÒ "GĎ gDWSDOWWF?jnA bO{:~GYHIƗTION)#RVZ[:,~ֶ=~\LE$T>aaL/{۰>Ÿ xJMen-ӇzH @.`&׷<1Yc|)b6[Nmy0T*NbdUHRmn ZM*f0AM xcª3lJ{,i/q?j=u3`[e$#O$LD6#[=%G)HE{FђAq8t)fҌ¨[n+-GW'žjG%bmf7Q/{xہr(ОK xNӸY^mEw23/;5{~#MLX7y][BA}>Ƿ1TmU2S>sy|jS饦@MZG JH5?@K}ܹMZk,%$> }o$HR _=i))Hf_t m}GC{iWDK%۵=ɿ=2=Ɵp}Uuܧ.At,EW ѶOxk<;M@q”dс[p{o'6csAbcB7'+{^LpD{] Z#o>Gzgfi'K[ gѭ6㡽0<8@bqt#Du%w =ʼn}G31`{\T~U EmAm4"B.`l@QAv=H›#h|SCA(={iNsPl{c۷;}TYa"(̧o[ˎ #-kUk(E*U\ /)4&"1XVJ&+5X;.;"2-ؐۏaaK ?g4riFV#mǹ=cߍU*E𿷆͜yiIhةaT]׵oƹR齛PobOsuOo'=tm'*Hu`Or.I|Ct:9~ږ)D[A{x7fYۧ& l)Zv<(X0_m# ,@{Göi⨰SM>6Ѿ23cmo?NW)gT]'Q=#P>KX9a1RbAh@X_]0Xm:~\RqLfb;i_91E{SǾQcSĭnױNȡᦤzhh x;n<.#R,A;{[yy .q}|<,oeyt8u.kĂ 9dPu_NTձ;m 4^Z; ؞MCnCnڵx3TZA;w<&M$?)ƶMլ2Mm{[nKgW X{`È'>5cZGE;# nXxVf!F7P}uӋgʚ49IgZmB;v[\1},Ho_hݝR}k4]swisr ϺM6m#",m V˥T&*H#rrM I'A^j+b?ZGоbF܃sݔߎ= qя6n~)zgH)|:ߕAI085 Gk;qZE i:gp A<;#6\ [xxۊw#Uk,G}@JQ4L$ϕkFIYVG$&=WaXIIV@M]}qç/O \,6ً0MđJiդ u>:Z |?[sd &4(V;ya>{ytWVU.۱Z6&6>Y SWX>߫4Zċ |x !:DsxE݁_E-oAFG-r?x8F,Q+:(6 XߒHِTl լzF]% ii^I,sÞc XsqƝ$3C#IjF`ӝ@0a =3'uIrp*FMTy/NO*NtLZv <R;o}&6Wr8dE,sGGcD#A;*4bw76$[M5Ϋ>Z@ o嗇ki^c{TtcX쨌pB{||9{Đl@koPDžY.&һhMy_Sχ7Ӳ-d[T7w﯁μ(&o{W ؜H׻k_i@*]"<-m$iIj6e,m[w$iW9\.}{ )1phI4:m{u#pҤ~jx][LTn$Ŗ~xI ␼=oGD;Koq*+{*]2  nǰ馼m$ XǴrjHƫh#ު1]?m=V'nj{yVǦ:a?i`[w<>ѐk+Z>:񣳘^,UK7]l~!ͷ ;i5(oѓkf>󛍇y {xv5"$'ܒom~sdnNÖ>u"4b= ğcd*@n;vmLykDRU(`$k$h?one Km@x>Xo_=u~}kR̵KPkmxl?1NmN4mꠁ; Kְm4mxƨ<+9Y<hԎMEξ\jNF$ǹ#ZQ<0 fFr7r hvkj$T)>= ɖϧ>U~!Sٛim:x\/Io? ay i$^(o"T1ؓR,0@vaװ&im3}{yh8#FJ44""#'Qa؅> ۂ=U,F5RdPAp4Esk}[Pnu>" PHAn$|y9`{lk40Tae7[Kw9ͤmJqcƀ<}*jRG ml6w=myHvu>:_*$S -cf,vxmy-wk?*Zh*LOw맇"N@ߵοdy™xJ N4f|_@/[X{iwn9ұ$<8DSmoHu7:wrXpKl`n<=NtDDnu/{xvR!!$@| ӞI^묻Xm6۶ڛxלE*@{|xIsg{P<$,D5{ri3Epd ٛp$v;Y f A7h=6vy^k҉GDi^p!ЩX 1-߹67<^o ]Js+bu~{{h&nF|? Ԓ+Q"-saA}o9JE., >&:0g/:ʻ|R W@;OfW A4'40>~گظ˸:Z[X1E$r8[׿Pg<öQx]E#L {G<}S!{oR$f~{ u2hI$(G{y`qZcU,Qn"a =́H_iÞ|ƹ"%Vh o`,[mn~N858T嬖:v9@V iotBʆY"#B~⊭Uo{=Ŧu_0_ma_HKp7 oc&ݹR0]LX j5Ǒ=O {ioÿ/<&q-?U@ lTicvY#vc: H cVɭ`kXָ>> 㿷}XϷbSqq,-?O9ZH;{u#<05M  ;ø~aw666nG#`v)fK{s#8w;~^pYԀw̳n&`oa~|`S>\66~fa66%^%6 `n ~ØH\ F}.G˄Ǔ[q{[Gc3V›ڮI iq}=6a^nIQ}FmAk\ui1]j4'Aqߗ/:9ɧg O4m9Vn>6Csɯ5NơT\t Y${FKnFǛH1<+u"0/HmVY Aw6{8::ڠSj! *mq鯶 P[~u529@}A](dEf$tm/1[۲S*NpKE#UQ}ݻs<|0+|K`&䮡mkxݹ6+!M׿+mZyuMzh,FxE'{;nPDžkk ^SaX0ݷAk{p]8Q,7[r=<~^})ɚ]`¦$Y066OݏÍMnt;[ P4^usϮqe.-VicAFfc)ms0~p&l-`;QyVk#CLܹ:Xkr6knLf'$kpnt yx}gҧiXE[lHr/{xhz{u[ۧk# ~b隩% a57Hs}b{/A5ʞHRas6;X4~Pc}u#7pҳ vj,c1u-H[ԋa*2Fذm4Pʲ_aPƫoERQgab@nq-q!׾hMŅ$및"deW_7%^tQ&ͻ6vS|=i9ۅ$$3Vao14 ٘ 0> bVFa魀6x4S@ﲳ Xqa=`8 ۼtxi/)\ӪJƒw,Mat=,JK6=5TB*$ p?rLQrqk \|9 4վ[->RBS^c+ZĻi]јv:ǵ\@ZQ\«` c4ǐȤm'LJmc.MrBC{ˌ5i7)uW̊%rJIcCozD[mGæi)΁C]m7k^R,mkBfDHeeݸ]<-TX-A}=r郷Հ:ÝljcJrTZt?{dIނcn>+[] KI!Y0va^3F)b)bQ@ٷq%)dp"9xB .b f'T^^"λñۉib^,VTn>5BR.N\kԍY2v𸶼EVQ슔0P kx@Rz禴fvSkTaՠ&N[٩7]--V15=Οm9T@JmJ$tPq,J3A6p58"uJH ZVaG2 zDolu<$Ews~\*x!Zr4e=?w0R,5$kxVH[h~T+Su[`$"1q{h5M})S18TwK_~x㯇2GI2܀nEonܩr5~>Mcr{kyʚ9 th~QgxVZb Ml-㭊ͽq {wmxxry禟"d&N*J4oomH3(]uo\@UV^Gpu/}{[R!@T(MGp8 e]Dlgxc!;{,A =T4&۸[E2'o? j>~Ρ Ө$|y!EBA*C[O {e>:eC] jMv!h$@X_FW>Xc^5\yʤRGp|-0|~|8Σӑ4 ᮿwsw_hyyU?rN2pHq@CXڋ!*m8Ddj0j̟@mCZqٰ{(X(BA:6I-ܐ l|v ;v,lT8nKw:OS8K7 ؀Okϙ#]!'NPkOpuqHBvi#ho8;q矝>1"Hdm/rMO#1 /='[sVU,~ ݾNsXd!Ie]Jp~JmzG?¸'t`)_uZv]2*!k/#M9RHVʱmcL)Xxh98к˧ulZ+R3Ok+q{\܉]Ϡ7768F<v+;&Z?o {{^H$90j-ċ"gdNsd k_UdI B`x=Ʒy'<xcݵoO Yݵ/nnN<9j^>?fu޾"k-*5k;;frW}<ul 8{+_>p{@Aǵ{9<5lrkˡ&nG2%@Rm}ߏ(Q#bpX+J# oEaNE=Sٳm^bbor|,|9U>* +:1ԝ?Uan#n^ ~\̜+.vZf u u>6#.?/ymS݌z^/{#G"8,nu xVӍqڠ_w6wSrN<[1p{ [/k%N׷=^]s{9V`Y-ԟ׷,Pj{k#.9t#K{?O9$Iܟz攝B95cX1$4nr ݍ w[Hs_P<;ߎ q5Ug>Щo\k n >G'|\t`AhI6̌]g`kOo9הAٷp '{->>|y Ipߵamo>XU,ƨ}-la\{Zȍ&B|V߰_ǜ:*tӍ̉i~5%Ən.k{|>o20`G`/qotH'N$A#1ǹ6WsF 7a[|yPxHvgerR~`_g9YШ?t|u7? kQuWOx vǒ]?{|8N"DQ^vκ|yM{v>µX!*,k[ۜ /cp5ӚvƝ{ S#K[jo9$ӵL᮪֓Ԩ rX݆e&0BO} p)\:5o<}#F Nvkyq?a\*Hѯbt:|=kDIov\ }؋[[_9-ڃ}}pAErNamu=vIXRqJŻ1۷o5+#t aHýrUJ΋*UEMiykrFxyar9$ us+2O=s¬ÞEc3:G{_PMÚdGMpYK1/e \{k|=8UW-1؀E/c_-chVhnx}]Xgz\0箹f[K~c=5>eGǛ8嬉Q;H"otq̲,>ܝI4ӕV'Q4q 㜂l,F'Se3< g#dI}n\;y#<ϲS1岸 I㦣[ߴs)Y@?x#!oۘ$kP%,7k~ׁ{pX^t!~n!b/峫'}K\xyŒE:";1.6ۘi4o?ק㉀?% 6#q h [q.5#m3=>VVo^RD:KمB7.; 9NhӸbEs^u)zi2q<{xsoK6ӃhU RmoTؠ'IJ%d0#0K_7W }khGkir[q1nhq:zסܟ.Ɗ.AG BvV;|uT1wQk }yI-:[`5ӕU*dtRH5ݬ|.) {k<بrIGHEG0.׷qT?WH8j^6nt_u4{Xe׽ΝDŽ.p碨LSHɔw7'ǴgÙ`e$?l56|9:y5tMnU=ݷk㬌.i۰n00JfRy#NÑ ,Mu;XIWHhib>ix @ݮj7H4 ( \mt,tO!+X6?hlV FDF!{{mpxh>g+:z*k)0-[uh \~Tu(:z80-@nǞPXMSFd.{WG"$w:w'Ԧ$͸`,@>˸2-wf>t<'w -Az8~yl=+#C15qbHxckyYyVF a`p&G\T邤Wv[4q1g"4[\knq_4Oٓb:{5Pg%U&=)0?Z `$}x9mmNj!e;]χ$&@-`im:h=FX V&,$ܐ(V KZ/pRYZ@%@U"=v y~si,{NfۈƛYdAJ6nʼnD n W,T OygӷGeu[|9T 7Xhm{i2NdHVBwqmdceSkZqݝ<;I2;۹bEը&ʼnЀ;w=8DpDlubNxC|,AcuC9zS T Fӯc={o9&SR>[M4q>v@% mqvݴ6s瘪T:iT7,CoAY.ůD!lRk_n Sds8ՀNBrl߸#Gk"׸l4ݯ(yk4u;v連ɇʾ Z{m|~ Io=<±SURC"XF?jR 5n,`5ʗ/)7 v܉..ŀӵ⤎?jTM~E`_ 7w|M̕Q;u}:ԕ7bEmr}WB'Q@_h[M7]{󄒬HT7{{xY"jUu-< \''䁯 :y3Pj(B9%Ǵ}Ki~;OD=Vyrnm{^ΒH Xt&'g&PD/Oe t}nGaq̎D 1ύ QOқ1%w5aud <a͐xUiu.ά ذ%XwUʨGb,ڞmJlqvGܨ׸0̯koh MZkȳ!{Ĩ`͎' tP؛\|OϾ:@ ׽yconA7/}9H#OY^_)B`v?y) b0֦jUSh`=b6mԆ#[y"+`F<ҎOVtt[n$o) ! ·M4n{8H>xUҷH9RZEǽ[v2APF 릃&MM `ƺJ]abMG*6H]C\{hGp}}i&dVG@ n{Gk?3瞺ltkqX2 ?8|;O FndWv [s-(R-qca`OSv|z9l֒) H۽}{y~f P{5NndLLUM Ğm><2oq;I`cZʚ*;V׿&Μ,fhu bok}ƚ3?*5hJkb#Ηhm#h7]oGɝ`u, {ipu4Wp,?{Y#$v?g~Ji8GQ9ҵe.i \ro#_#WCojl>V5"kF,AjtC stSb{[vM:^R0Hh6o `[[t"׷}yROq=iRq*eblwY|DSqs/{\vʰ yZ[L$ @mԁkq.1QM.#Q@立͂ARu +xN+3MKڞCK}-{}m,ݔ[S_z͕&&2b8+\IX_uVnkKD+&QsU:Do ٮFKyt쭔mRi&He1`Emfx(eù_ 604@ :VL'q!Ք1"^ۍzfq7Zmo}?4yPS#\U]B]dܧoόb(h)8Ҫ,5_|w6<a ]{ d&[Dۉ]T$k!>={g68tVMzd%K;moa tx5?U:sd1] VC{h| ^v?L156cV)$&-VȰko,^]dm{oFe MƦ 5d*d-%Wch@x|<9f5VﯳlyƸ5> amnqp1mI$v_~htJEJXhXܞo̻Ko[ۿ^T5Qdj۾Xb _e.DlLVtG1x;t1ss*16Aa(q>uMk_yySmm>B٬_V4ʴVeEdp#ce7"~T9Ɲ5ɄHmؓuytl]a6O5ĘIK,ts(rI>^s+ @~GU^GBUe["k R; ?o)4=5oqx h4bX=439f(2@**Ok;?炧Ԩ3;{yܥLaKjFEǛ+RPŊX v6^jJn`qkh:t^-,P #2+iatrÆ>:tb+1 xv`mdQfk|8XyҔԁ ]`_}~<1ȀFA܍uhm+G>z}Q?[^Zݻ۝<)KRCj =mO֗3ЉYҲh&6mЙ>7O߈Y|Gl]׺d J=tA`UI3\nA'Sa?wLjyk~:C9ݚ4M ,B {6A2m7wMXs-b@{4Zq-xusۇ>qԙiH5@P1;Vy$vaҼ+C\o۶{ǒ+En=' qֽ5B 2kH{8XY47^ >JY@Ew"A="y5|h+#]YT`Yqo rBʎEX{f< PH"Cmڀ5ױΒX͘0G91=2Lc)  .@߷q9wQ \O-iq5j~Nw@WvmjMbkҩ$O`HmVd^O\>UX'Aؐn~g"J;Nm__IL iDn{Fn9"F鮃[[sZ"1{DГ{n6Mڃ}CQq~zg |sQYXŬ9W蕍a۷n׷ߛۏL{F&_hٟmЋ͑5A]q pț~^`i"E$k[לb[n`AZ$װGhl{ l*E9SP)h-mutM#`6ܕ6>5rHՇUyHR rwxSmK=?ӯ+00%аB7vI›OaKv:qWs}QO}u9N*4#C"X@Bnt@> ='ۀQ8Vqsedeٴ-Kh{mΐn P/`ξ:_hW8&%>Os0] t?^Sbȡ ]A'y'rӟkeIR$#QT$[_eT b@ Mk0qqR$o~ێ}S! \ ^aA B%+ ׽{ڄB8Sw7_7kGܨ| +H,{u8VVf2lTxw^Hv76~|d MGNiAOkۘ`{Y;1lH1įc'_̑ OOx|9B:kWi#(7 m{=+E ej g`خn_vķRMb5>-\RPdm?8,tU﻾N[g<5iy M5#]oo~ytlV=1 xvǿs\0$ܝ>uN]"dl5˺mۯ{{vIԋ/Oh +yXt:}{>^I5Ѓ}uz؃qnv8ԁQ٤.X}/^qE)BA>>p<2|F,l /q߱:sqբ Ըf_1mk^{q{npԏgÊSZZJwE[.mr>>GiT1sfG5x*c*vF@:M[in6+"e$GM>c+lPw\_{|51yYIӹ^x~ <5AuPDRart`'ߣ/8ӄSEqQH3jvyL]^_Q6oo*yE2 Húj=ӵHOCPg \_ܹ[kT2ԫ8 kD ֞Xneohw$+)-#>>v犊vxׅcRT};Z#=$M"-_B/. VVhqa 9n{v>Vŗ[15+Cv_K㷁,6WV6"IGRځ9 Ik)ÅlqЂ,BEOj[ټ6?aP<7B._4bq{4wxgy|Ŀ>=ySǞ~4$YcU ۷GjoH-`8ƴ)瘓+\5.ߗ"3ȪK7>?3O ^QD0CEK{׿`-}uIFb=ϷxƯO0K U]PN\BOos{?>jyVeZRHV&5 A}Zs:B ӷ}qWʡ4jl$;܊M`E4גV=e|yBkӪjjgVR#-[^^s16rxgғ8M%T0t[yIRY`dkh:84 <Ǟ"pxAO+y (ю݉Fo}*Z{/bYRT^iQw6$n77#9EW n.ө+9\O޿cq \kOՍ&j0JWamrBO-h(p$ۡ6Gą@$x1bXTN#dmx}nZJ4 {>Rf[5MۿcIQkQ)vBko61Jںx;M~H8'lpCJQơU>ǎz)e&,2Ɉ0Mu{־7ʟis=%3F@+D \(pko\4Ƥm]s$=^ױ>::?0)0k2}k#8ym@i6:*"1#""vП&ڏog*Q'gMJ!q=>m [OR,mY~d[8Q' ; {~4@@xϭMFꑛ{{[9(bR!= %dׇ"Q;HThH'uxV +Qy7ĎrL^u@QГq[ 9p(3'I֙1CFhe+!Bab% wwO~R@6bJ@$u~4,ñ0f80FKyG l j@N܊Q\63\ &:i4 aI= EԪL1\@I,u#~##шgW*Ѡ${9;;ub{o V8$i]} '^{>46Սm< ypƜW}?+P6A }:WWㇿΎHP^璟hʺ]߷ӯ~xVd1siRZ[#q,X"õͭH3RD C\Пg:EgE-mms^Jdϲ)) IP/nOy**8⌺܀}[~^hQ<쥁1ǣFр}oh[xG(€pA$L|9T՚A][׷nKkx܁)D$pX ڠ[Kn_Ġsž"%%J7n?l1!v;΃)R6sӀM` h&22! [,{nm&c>i͘T0ehv[Uԕ=lyߙFDP4?Ǘ2OT>9lq:*ՙ mE't$bch41FVDFv`Ha܅_w -- aUNVI!xʩ!MSFJH7׽k}NLy)Ѐ[=sakq4"A =[Q >oTsa"8w+0[MI \wi/|w=#}hT`*#~]͵m1Gqg 'n|t#xN}Y5X7xάE l`/{˙E禚۔"pQ Jp,@"\9]Eֵ7a:y¯gck ܀NHW$;juMJ`heQc4#@X%;F)txL Lҏ|N|E9yFhf9]CoW' 0(Y b [p=v\c[O("!] {Jc'6'o(I^\4.zl[wӷ;r>8WrSOBo0y{u}\r5fɲP#;rw{|9"eiV8O?\ơKCm[ym!S{rʙ).KY,59걒 ;Vÿk?ʑ;kJ8$ Xksd_35}vӎ<H}$&V|t~^pZ {>׿MhaC.}ʛ,Bi\~>9"->>Ʒ:uUe܁nXb>l p?pG#Nyl+d%p_x؋۸;sOHQlA4uX+Q4 0!,$ 1mn>O)Ջ.X-5?QLm~TT#O= Rj}Ô^WDVe -m5j/pUXA\¾{4~w# m羼xDWh9u>V{c4 ΪoʹF6KQ0C{3>tUvEZwP` '۞<^ W)E͋}r o\1r,~O1[0m#7M~, tZ@u^w2KFGM}(0nI&2A b~h"SI/~^.K ۠匍LTT!PI='b%E;oi|z*5#r׿9ƭ( kGOϔ#V>zհHß]T4ފ{X{mA6 H𵴰ӷn]FO֬+}@Sc>#o/=NfmSniO1Xڍ;_[81sA{߱4uf0X|4:_P<[j-hFvݷ=B= wn+?Ҏ4O<;P23G`.Jn1\cuԁ}yܯm;u`#S`M$ T鴩x:OYO1[569ak\  ē~>K $mc~O Ą ZΠӞJXؓIrG3u6g:l{#v[w񷳛HizPmVv]tiry*iF^ j~"ǷQVuH\o9ӵaP57 }<*)X@$f8[yi5_S_qS}>u<Ȍ"[?v qoTH+*]cRadوѦACga2rGVuw!'Q+ B]Ük&q))ÿAQ]q3[]~ψ=^前6WN4BU"FN/-۽s c^܏@RMT,lcV>Zb5+oǿ9 nd\X>dzl5ut^u͇.F߿4LW9H~bAb5}~^s 455.D{}~-, lvܝwYcUeI*h-:>=w{ kiʓ8zJtԩvׄE@V&i_R8PQzDV= 1{فXo ۆW9lWcX?w 1=uMޕ%U:]ϸl aFXs©X*]&1:lj8H}ču:ߟI矝\$h`~dđ(}#Q˷#TXc$FձF <8HB*R4>6qmh0#d,ۮ|t^w20d+{ sJƸ%1?ʶVQ{ kR񿝪ؒ O׷? TVz tYA!o{hHu*c>[_ÌtM(MS+̱ݵk1:kxzl-( uӡ{x[% 5eƥP F_{.5^OAmxxT~Jj*Om3-gm=e ׫ĖIe[4=GA(bXm~>ئc4}6:6L< AOs|~JQ8X%xS,kA=w;Y/kS™u; _mr| *Hǟu6z1d_r.}>:v,mae"q>''gM^LRBf?{>0T)$@ϴ|md0o{ӑbpa{q~YvRs1bsbE@nN!@Ssq㭸숚ʈ(Ժo, DJ":"qyB@RE6wlZN06 }>x -鬉'TV{/8=P/$v:$U2pݻ.cUAؠ6e+*4EpEbGo2#,cN׸Gc}=ϏOI֯²E%@/s uďeсRi|#0uw,di >XmSDW6RA#D]0S_ |<9Cbƣbv:sP=A7#%~3&+aj#gI&NrB{hXwk8Tؒ;$\OlRmbbJjA p+t;}>'5즗Hgʔ{m{6R;\Ykkůs|G?hҺ"I*#{܍ƹ>4In-{}FnSsJad,ISk8Zhu i$ݠȸ@<~2ْ|Bkb/7Ѧmw^[i@v-Fco䕶ܞ}hB RupmM Ti`}'X.pZHETn+`~693t&MO6=KҩƜ*EK}};kr` ^2@,uT"K #B&'μkBpMt6s϶Gmi"?Δ%7u<馌VX؇Rv v_!\"^[ߞ":ksG $pmws&氕V5yVj$${نE;$HVMy JtVcNH!:("8i$0"0 7(X)Ǐtfqu=>m@DQ%JPr5P~ոN+ }~7yBGܱƺLjDZ}/5ut&n4g4Yz~x-V$HDWtor_'eiQi_4 &*HlsʤX*HGa.;񵍾ΚwǏA?}jbiۨpݘX(d~7_hֈm1y!WZ{ rH¸6k{ +5NDҮ!C/}Ot n:1Ik ߗ `hZE!6Xs5a{;k4k`V)"QBuc׿nqin$mۧ=z4R,T#=ﭽry_M8K vSny n l›AMvn$:~cT)b6kȱ= vFXċߕƜQ箺IbpGtq]{ ¨0¦DvKER-6*<;bIXkaixf55щ&Kx vגVYtmmt |xaU y"7H)`/4'MpRTm =,m[8yʝ\Ơ@y'v-cDbE?ܨ2I&T$v+h?oәF@7 n,/R(LҠN\+$i94AuÖ`*pM67 nO v #iAvx|~l8{yS.hD u m5yȊm[ y<^JS -(ڱZoNkZsڠ]I&YFA=mO9CH7#牏J|TTʔh쯸b6`>7ɨpB$O3VygTl|ny*ݍuiJ>󶔣fĦّ 0 O{=."T1 @F^8ʱu-K1emmMFRR:tk#>6襌8t:Cë~IKG)YTوq`~$p/s)$ vLЅuÝzlVFPCi߷(hl{==2dhp?*Mb;1}OfpFYX۸ҷGgIf_r{Y(g1*}"w:m7 N4f0tv=k"#lm{-˓Ϊzy})*uI5ܖPNX9yek{׷LWkRuZֿ8ۨ,I&`3[}Wb06bĐ5'Ϗ,Ezys27,lI"Mm{;OExEvC)2݇${r!^N'VI> 4dkZRbaCr %cOaas{<=\g8`(cnj_2Kv6(xU׽nkN?+™$yEkXG2(1> K7S=<+V݁S}u=i\n={{yδcGa{kj!@:>sm/vUEr1^F)~ ip24cR -̚ԝũPI K;6p;I#K|nƭdK)7TPZڒ<,O8(Exm9W< ʻ7ڛ#sy 4~ j+aόH*M:~rJ .m{{8mH=h>O#i%\{xi1[G k߸ۿ{>\ m/G?:=rV [a+w@'S_A1hN5Glas/ܧ_`F_jKF &cvX=Ѝl{_b_Kv jgJL5Xpl,Ais>tuFF4w[NݴFڈmGgQ$,IOBt Ab-#<֓3[&W 7$v@2"#Kvkߕ畷ZvaX>f'!{ ŭ{wC =j³0 ̬k{xc\Tj~>7q'pҚdF/m}Xܬr=*I'w IVҧ;OZÎ y|kZ$2nZcf݇9!urE*p9X\*fU xG>7GgRt86 _S cq![Mf7m.tk>? 9o6> rUs'tSb;_r{_P*M81Y"ܴwI@sqǷ2 pnEuӿ۔"G?MhU{Ug]I>mDpøvk q+@ɩR@ھ۸~{H" #ӽ׷4d^5 U$Mms$l 1U:^r3%are'ӘD(R poya^SiXdR-~a#4|Xo$H&!aX(7xsy Qu],oh9*^!Rۉ } msj_-~ڑk- 143-<=۞m]F?w"YU Uܓkį.Oh;r+79f羾u^s[[h,v1E9̀ܺO}]ѕ]\M[Ko(H=jouN+\9X) k@\6#JX4MZ rVgorH5"׷1TT`|{zsF>ui&Ր4` .piC |?ZN$aWMǀ&݇{>s qeߊR#&6l$s7T7lWM _[I5Л!NP9f#]H ma؀?_#ki#^P`m=r4..ui΂ XZo}p9^Qf`4١G3$l=ʦvUM)MZ=ſ-G#`,l{}xV&#N huqs=G^:\~ǚoڛ<Z3D;0$e:w;[r 9V lþjda;i΃%Qn+abmrn{3Ȫ{AQ{fiu@i#Z69i` ' {2m~DOQi0 > /t`C }&㏫hD ndI.96Qciȱ*1Pl c^ֿ~8H5Dsm8TC,JN핟i$U-]ݼ9,N-ُӪi9:I77=m46mĮ>Wjt4VZ8 A ts-H >Ƹթ'2LŶXh mQA {[÷Ǘ8VHj!JK mXn5%qm{ܓ"M_E$ɯ`g[ ,׶GߩͪLمԳ'_ qšVxOw`\ {$5`Ei}TQ(![m˩c`+ 6/ǔ_q`;}~?E) Z4eRs]nt`}%9[\i{g"&0OMO nmccEi^mFP49  +N;yS 'ҹY\ۋoi{ic{#gu g+;!SuR?]9@x8s'\g@Īu& )@tcIgҐAv1Oke,n'm\4L䑏=_M]$w:|{7Fasa~ڎ PO#ҤQJA$~_DFpGk osPqWjdGX {tGɮۀ6qU'nJu/7{,@R<}m§m=00ΧE0ۉ7{_Bقvۧq q!"#|m -b~Gq9´dQ[u<,sy"$io,l|~u"iЅ:4$ѷuRM;_v'p8Mb6`4Sc^9$6BYH:wjSDA&=m;5{9fcp@H:l>Ii6kqQ`U5˕j MU) ƳG/!Ar#[~et:ݭ;r.YuyWF*1%¨ y+q$XF=so*&MV\8"?FiJ]q# R~=I ǫRea_ txXqNd} 1m@#c$ b6t׽>߇p)|>tQ:)O☔e,@K(Er } Z&_|ok<=q5)FT`kA9;AL4 X&i/;:yzH-9a$||GYJFe5KxV"yjSꨒrX, =gnpiPmٴ}ߗHjpf}8ܭ؏H\>X{y)%ЂukbU309_ngEY[0SccqK ~ŗ/Hv_;  l8PzbZ=5?7:Ov+"&ɼxnE1:&_6yk:¶B̓[ *x߷MO4 Bms$wӄA’uo(3fZ^]ZӖyd($yƂ9(1CV/C_Ӻ f,^\ts= bmoƝGSmF$Xn6֍.Ƃߗ$PK-M DvnCm q:6fzxpnE`:;5 ; xp:VVĝj^R  Ӆ%҄\"M]˨_N?wZVPB.Ix=wXGTym#"68#owS` :,~'۩n[QEx'1;@ ^A`G|O ߽ ;n;88ǿ}<0\C'mOhE;[6)KoHom4 P{.OQ# SëP]laH{w6Q8+F_ۯ4Znhbu{O=<j@ + ͼr :>s sp-dȫVY6U7oJ $p{>3 +2CU7Έ o 8 RHu*6jn,4=:,x}w@OpAǷ,Axᓳ}xӓ& ٛ]_uemM/ǿ񯺬NŔDKj "[b0Wbʦ׶?_5@&̠kQ'qߜ M~?E$$ {;H#Gſ.Tvj&+ k1:,I맰I*Tm={EON8@ w)b<(M81@ 5qdϺ})ymUw-q>>y@I" ` Sb4ۜ :io r 5PJvWKOgR5*5#>zPA}tǗT^*؀ 9rWBr4~_HPvTqU`_{\ ofX5-ߔ Q F6 ˞㝈Ҳě~+{V[k0m;ߘ m[uw6qsMN}BI6O$6j{m<ףg]b2?xة~fTEEE:_OdO`99DdTig_xptrtO R5W8Ɍ^1n k0Iζ~:UN^R(Ȱ<$vNj@}sY٢oh[^Ğ_M=BCZωTƻGF: E}66upcƨ0p2oyN@hJ*ݵ4n4?ZB?I2*UMoS)?j^:v?)>=_ abib<#=͏xcoM;jCFA,Uk[k40sOfBx52)Гk/cnǷ1uָ=xy;lR{k^ن ?g4)< <}핣XXHc矍I"mxsG~M?g+<)9IQO*Bl#i=xxr;BoIN|z5^rHH-'V&*zk ӳ͡ ?>ߧ ,hm7_ |n9`#g>߯PƜh)WjnڻEx/ xXks{OϞ<+dbDXW`7bbM [V}{Zp/aʁQEi%[1+kcO4Y+W,"!E!5{_PTZ´F*|*DL l9()0?WaQ^YeHF @h@䤊m_[?SySP}ī\{ wd!QoSsWJ禢HNme`E<.o< i{=ϳVyV z8JyArAkVbڝTEr =^}5yY*wAks kfR_`sJOO<Ъ˺FoG<ϹFٯ6{yaNQb) ᯈnu)H'Kx/61VAtɈ#Smc؃o>s H9(l}>?9}Rpieu?1.ýɊ $TG)meb4<,s,lHǀe[ 4y4HP\/ێKK,̦6t|y2QzZMhĎ9~d'ܿ {|yiwS@_ޱӛ =>T|#֛h_3#iQ|y Eg)Vr/kakXS(Յ@Hoq~;SRD|W@GG}8J*Ҕ8,"FKXJaN$ 4Ѹ TwI&>S]O2ULG~o(UEk'\`Zk3so`A_hJ~4Wbܑt.˶ۀ45~0jԅy"iXo/`?os`ۍ w]y覶WD>5 v#YdÍ7ƹ4sGPn }Z#FMX75#Iů؝[st9tUfj1'Pyt 5:G'zy>=ױwpU5%u \vydj8~5ƛ%F[E>o<&x*meCo'pR[zx*p}[l_,}׆W6#Yhe=X  i2`EJ^uo5vb5k߷2Y4Z)$X xjxmlt*z}#0S? )D2{-J ,:GMRG2"[7nd#"$2Xx\i] $zq rH^dM B2ylH$\ io`6mr ~Ϗyp:yV2݉5}~r΁kapהH"U aH\w^Rf#ۧ{y 6'^v:6sUeDF1]l4B3Y{۽īIvjj$+%*z,[u-rXjn-4&K3D~bTb n1|;*6sCZ [kK/blh?01hlmؑ}?VȦɧ(xͶssm~;5߮~DitQRqnkmM籿%yj mMTג:RaA'x\Xܓ2CJX :A}<Wz+]X\hǵd T5E67=>:\""_P>oks41^ڂ,Eqf#]Xĺ ÞŶRL?2LQKGqOM 0[vT od܀u?E>T1P֙*guT ^k 蠰S~S&354#Poaa X;ۛQ:.0~=F}XN] j1-q⤋9IۇOT-^s }n {>6*E:|tӜYvC}k<@'^UJVH4@$lA"۵ { ncX47]|lA^Z H%YQ$KX}E Ղloᮜj<[OGgZn-G-o("l[ǹ׷,+  $4AU{/^sy6Imʤa_ adIN6zW%N˩GN]"6H454+0bUnʅj|;|q*׍$ ,b]A@= ii,bnoR4NFՁuXtyl$ q]']| GM-E. bTDv#-`um] Tot z6j߅&Rv#{w?g$W5ݰ: w~1 b(E& "@JmA~Gu- [P 4QӅj*.S+({]Gw7 `i#KG ;A]ouۂ Bq'ӥvٝz(tq_e4J~d.YjN; 9k"}P'e(4a5TҘݬ<|5>&ZPLd;F-s.xI$wIDǼ[u:۱g3,Ya0Ne'Q让a5בuq`Nkj@.$nPȋ`[|;x|O(Z"RV'`ы=J׿8J羞ezTӀFnm{ag<3Hw ^΀v. 8Y=\jFYmH.q {w]okɏ--#W#!fTn^g-"{IAIϞR4(lq; 7*uU$xi6jU-P|CMp͂fyPn߯n8EY(xǹsFp(M'jئj).{񮾢T}pXhkOTvG>(9_xj cbt}$D}7{ZqƂAxVUVix+g~ajj)`Z唩p>$A*vWDs{mY|/׌bX]t{Kcsn0yHhB1A,b mיJ?#&kcM@LFuU.@{ow{>=y9=5=4ґXUʂC(7:9Rk m'ηkU#k nOt~d[Ymc Rk_$%Gﷷ}><5})&J"{h>R{[NTcWʙCq{F C9u}E7 m EN4tc^" 42k̫3u Mȿ*-5#5m,oӝv-}q;DFZv5Ѱk|{k׍+u³}l>۩l&5Vt6>ltg°=l&-׍ :e!f{o_413PjyJ)'A \}]UD{;rWYȈ+MEK|9$R݀M|-ƺqӉzyOLy`W5۷bw\^.G{$VA]nķKI%\[k H}Tll?F˸P.{ir~:iNW  kckvӒ8Qz32yҞ1.7;@ؕŘm;w(+26'22R*K/q!R4/.n`nabcEoۂU`p4o5+$6X[131;B}U;iƖ 94S-{\xt#W"H&OXܒl%Xnn5hEv_6w%Y&$wfDd;sj&0l(v"ln;ߝȭ0$I÷iH)]`<`,X롽|yz m&M Vl_}~d{^wm8t#`A3Tib{;#ͣ[ sGN 1~`ȠָßT ?HZH؁m׹@IWT0n7'Wf#W8 {3!u+ AN(]BNǚ'_>IaJ$_y]vH/_Cサ] &[HG3*.Iioג:k7!^0,ɸ׾Ox 9 |Sr @7K:x}\,:76?Mm>yANCT*$vt ٧*K (%nۧ@G"yX&g=$aW*)}> Ћ^7=L5*LQ4t_uV#Kv:kۜIvi-ӷS,M7E=<[߷oȯo,ٱH$l]0.n6=Ǜ kpNʯ31-k?p/Ù{ .]}m{ZxrG?m^L|%X @[m[1؅;A[sUOUMeG>~9E2X3j{y>U\s =ߣVhI؊EzvYʼn7!D*/<1O! morʻ :Ϗ-݇3WمCy 0 qMqΊ dH>x[6Wt6J5=R`nOmOcnE&*R0@*) Cpl(,BFrw8?//nH( 'xs#Y]O{۷q5"Y,{[-?8cm=}oeMcmrjɠx.믉s"H u^rhaV%1I+ |?_av,mrNcoglaǘo<*asb^o1? 4:[K ]{:vqh{Gc׉w$V4#&[<µ\/ϴ a[Vj\k[{D[Xy|?Wi%MvglpGSq\zb d6Kjy$ZL@I7xG*S_Ԓ@$}\骚eX sqRikm:X-^}k"k'r۠6?_2XM*õn445ۃ䂅X\Zo&﵍Ɍj#,NѹO?: ٶng a,HB  }Eqa~䨱>߯9Z $S~6Xu( s9uI5rfLgث`7k8sn٧ǛB|7n.7܍to1oqa AM/Nn7sAV nkI(`MK92E?Ǜ4&9H՛NmyZ4sϣ"X Dږ{{s?B)66ud6ej<I#"aogm|>>˦@4.d rԋ\ '78ևMHKTP ϰG8]dgB}@#lVEa K\븃YGcMKkkOx[V,(ꛀ.BA?}'쒤uCo9x $Ӝ]<@-k Gܰ:ꫧl{ ӵ6E_Fq%Z^M@AK!mdRobntCD%n>681VsQdh")̉5Eo,:V7Xs7iks~nG.+uAx'56yQ1}4n7f+gHc}UAV~:vK*9`mtyNTX%y4v/iip^dVl?gR-q\Af7]_:0W:J@HX/E Ob@'K9xZ+nxb/r`@nkZ͑WUB$_&_ѐě(%޾0:i <9a^8Vx)^q奣Mpoȃƹܱ7jOi)6s϶'4E%^ `C6؝-p}*>8x;Hicr+FO_9~gTi M᫊> ksb -m焁?*p9i'WE $hAuoaMcq7kHǞ|a]\E,$я6@,cw-my›۱׎sTKOTAh;CĭṞ}#B8Ha˿/mF-xY>T 9 /K2.,G"{Q`ŀa9<Ǫ Q[H)٧`/_nq*~~7BP/ZgIv3]\1=ǑkC}vZz*|SRHFQg =;\^:,q%@ s`7_͒E^Ne?K<mFVֹ+a3E@B Ǹ#xj-Z2NC#)^6:{x!Fg'0yf7!K-o*O,ۭw劉; m"r.FNO=V? "ߺqnAw xB1 I}$o|-`%C~_}ܱ1WOoYXEu?evm/?<*,XeA{-n`54ᇽq{}FjTRot7p3C>/(8Jkds9:s`OFf'M}DRЀ5 IN},>D;X!?Adm窬S5;{k;9pK)"{ > qըs3[@*![WǍptǾ{9>e[L$| 5e-lB> ca`x=TyUU.Eyx1JFG<)Ag̭o'5{SE"sy:b@]ag~JOLq”Py4o6^i:Ojpd["ONJXXI);q>U cP:,uF;KN|id/{qΎvԩ(u| NxS/L`h8J8ᳲ5=’/G񷊋ݪ.A#[ٙO\u`aQ# w'WrMcT7=5R*D!g#Nqa(=~o4p_y[-qx̞b @X23 u$\|yE*B:u=p@ҳdz̻HܞGRcRIv_+o>UB`TJI0p;D0k \G-8tT4c m{yzjh֗=IoA'ǜ8h )jںٞc3=M_mc [wk^i}9RSMGYbAd^>/Lʦ"H#[}|&y>.bIHLb} mpE4җLOp[wu9E pL݈‘KAv^W%W7?{9BA<7HͿqT=vM`H(4Rp7?]5#]t!Xi`dW)wSb:z}難D78ﭗu}9I)PE<5$orqVdǧ;?Z3#6:Xg\vs kv7Ϊ}&("}'y:hMnגm &;5R1yƳ7a3Eٍu6W0!jOlֶG8z|*DqpCp{o~qC#6` [[K}-jßZ, }n=$G-"BE_T6Ti).1}Z <>>3p&Ǹڞ O>ʁee=vrcPw!Mtn1<+JSX{uFNݯk߷' "J=bu;þSÙ6.hI{?oɑ^yVD>TDG@o Mya'{]>@k@AP7#hD $M~x[P}=*ɼHoqEeCtw'y5@Ǟ~5y%24u'KKb m {~<m -eH:.&WG$ooRcyI:&m*OfM~$7C{p `gS&K@ax[R-ז[{6LaO A7F$:iE Jc(`YtHQn;5kU0mb>],u$oބ\VӽaTzz|g s:v;\e2 {tK wDc>r&M2C.ŚAǀ9@R_؟h&q+`kC9$s .9,WټuM=tVI D * k>ɵ`}㦞 ^ܮч>Tq:GbFm/2@d]maHj:e`f-a\k۝/Ա۱-Z+ Kr?_o0\4}><8Ƭ G cx4QQJP_hЛIG4c(]o;l|XxiXȁMBG˫&)}N!\',bHӔ>

4xZMh6V-z¡NӾSuQc"5osN"xf$~\7VH"ֿ:s,O2$cpA=(LW Xv;{.lT1 nN[2:RI}I.r%FxxXgX5@[c۶HV5SƁr"+4ۘr- , +cO1ְ+(8[nۈ㯁8GMA UMpPl*M]{XߌP]j-Ix\,IXŁmsύ:i+$':i^Uu %\WP5s{wwf} ?w۳ϭQDp =K r{R|E MyFp=y6IH Οe$>꺰ck\$k;c6Pmm-o8xyցj\EPۡM@:6($\y±;<õ#ۜ{^isj+v܂4M΀\žBcj^w^ULKA9(Kk7s߷ǔ26UhXvA_7#F$xƶl]gXFs{/xn0vErh*.G|9̨~MO?7"k,\FOZø_9J,Tn &{[ƣCOo ~~=LƨU0\yP?xs}/l)jhP ܽkxĎx/vH""FA"3m~gSlwLN<y [jo%5÷ks[91Q?1HN{k5+|9m}DaJxߘ[޲$hF5IDcKEәO'kܓ\n5mYJ?Z ;y7!G&ݿBMk?U}jH"鯈9Xϙ !O}ud\ U /{4a*pԝ,mUf6%Ibީot_N?HW[ۨ\cƆӡ{4~ڔdWR5>_Q>Ӗ0\I vמD7ξʙAm"QPorE$pMl=qV^Y'*nv"܏K!wfO:F.0FC+dIv:9t3^s8*6rIms#fmr+Չ+B% sp9ةݭ{~Py*VU؀y&ē~; ǿkv==;sG@YRFfT#"ם)7[1\ c8meUHhG7-%cb{Eduljp.}7bI}Ǒm`AIy*M+X K׷ 8:j{Z{>(0BajpV0GfBnF6}xPY3&x{pfjk # Y Hڨ; }/of 7~8/LDQW) Ӷ0t' s<>a Qf׵E8~ꮮoh\ {|qor4g~91Tx~:o3޾:r°Jέi_#P߿: ( /}|{[Lk$Gt p&nsUJP.onto*q8mN:U\?̱ k4${;-nhmQha;7mEnǜ {$۾[j:u*>D R0ںX| i3YOW38l ;y'P7[O`u:@m)ʣ͊c@Uh큦oÓ*i,-NRGE4&J#^{[xh]u %+<iJæ#**uJMV!~&<@ij"8uÞ))6+ƚʜBQא^įַ&|}A?_/5Ņp5Zy6ٮ4 Xý2*&Ѩ&ፁ-$Z&BU<: xE42ƴk1'[CJj*57_sE1LLӲFph6T-$[̎Ŵ[tpgp}+K;X{׿w<촲>Ƿ ||n9/ehkA!iG8ʃ<r/ӛv$zX;E1}~nj ڿ|Av

X$/8F(& J}&9e;t"]ObtZ[zgؿ.a1am"AScqq9b3emBYӽJڸyՑO_O*iMb{Sk%947[{EE7K}<7e@hj޼q_Ia!4)ouc݇۶ _\3N1Pk)OuRʲ{_A{~>&DSr-6 r;I7e-poq@ÞMrp,v XhXvӿ0ز Лxir+s]]`mcv` wAMPjm;K]̠^'*H#u kYʘ,,@w&AR `.۝m&ZDIBJ/|{9:6,{ w?O'6a3&$t"QJ.,Mrlra}o)~uY%O54]nǙMP( 5A\ۚ ZXێ <ƬIV u^[~UZSJGrA:\(2B }:ߩZ'k@HIbVmլNۋ}>ַfr=w߯Kqbs$i]mcr[K\^`RAL܋߹[O;5p5E#k mk_ #M Z{4 5Sj5E!7o`lunG.c,|o~\lT,PJ(e&T{{{}!.c}bgcE'88$5 ZTc 0Sm/^ ܸo?WeNI6*u lE5#&i6x 9U6|iʆ : {v6щ//^Vܓ#G:sc  n΄ Zy? "C t@;Wإ cpǏu{qlm#avrh[vm~DV-g] <K_y^'RĎְd߱8}8jrb[k&'@[5c:R $\[{܀u}<4xKq< c*}G4>+kujy64dX[ IO쥵m=V+\-n)mQߌ,E }g. HP)a.s|GT*p-v cRIg;N:w[L5A %B)ճaa /}<#'Oh^:0nhRJb[n]$#Ȅ9m͍`~n>? Wn^\XS3ekjI[ւiYA4ζcn]ŬWc=wMNũAi)MxrWH_yFk߿\*T#$T#KQv mas o+ '1zGS\~bp_}ɣ6N Ij0}tSpT|p,q,ۖxpJZ- qfsq'p[5ӕQ4jc}Žӷrݽ˶kȌM[X{9::,24!f>fmF /<|c6ҤGj %jFm5I~ו3:hQNvOn<7'ÑKn6Tc>uQ]l>ݶ[߰]G2h=ÿUEQ(Y.l,O{[~$v  ۿb*ư3;A`XKk߷ݭL6(# .?h_ѷ׉5(iG#R@G{}|QKKj|Ocq, j{1 n5ss0pg6-p᥇ͤpפSjcOm%{sfI,eDs5p:Bc\Ʊeتlq:xGvcpXjyqv&sÿ4 *\4~ KF7?<䶎C9܃D vz:r GbMKlmO ᷯ;"EiH=-`5̣pR S^v{/{ʕWslMwPI#^\QʇLZ{[{}&cds8ӁF<$7F{vלk ف`=2k}\V"9*X ..<õim~$z8H*Nm'I~{1n7_?띕m`6{"ߵ962o,lA_ƔuLR*{JU-p{}s @waX~d1^e4iYTֱ{NH$Xm5$sJ6.\76Mr]OgM9E XwyU*t嵿jPUӑe4j`,-xBg=&hM]bʓ|Bu<{p-R-p@m۞ki:'[ X>w) z:-Vۯ$y]72Z$ݾxb?:EcS5<ͣ` n,=R*5vɣ!"QY % _'Da:>9է  1k4xoάw{i~s"]rD꺍=ʻؓ6?ǚU$T$nJCk;s]<}nYjm`|C`27PA8[-pEsQ5mk)Mkl.: <;׷j};i#Ѩ3~"4buX {];sw+䛋^91[k`D[S&/Xa :_w uגTH]FO+>TO9)EǏӜy{ ׍:}*Ms Oxn'r/駷9(*UM\yLVS!EF󢱱oh:i̓8׋ Hu$`[I拂ƻxƪI*YJhX!Qr]9%") KkaݽSPy)* ;r4 qsNM{|O5LYDh392`UHmT*\oE^#  1^݃|W1D̶M.I6L֙8zv)^*ZUfq,{4~J{5 Ag/s1( Ej/5qvsU8sﮣA#)r|9ԏ؀[naGWyC*3SpT߇TԸp }mߒ" EhZÔQvsP9*%{Sq}o>rr'-k^)Nu % c_tkM_p;76%}Ǟ;qoOjN2jD0P5+?әj7X'{wsI:©T:x-X[ wkoCK1 9li ?r&:@ɯN頊Qe}.I[ǘ & {ix]$[RA X0W~RI};,Ds>UT5I#1rHP/_0FQ6I߇*7Xv;~U>ϧ8պtĪ[:[xaѢ3W.nnύyyS*Okks+yeo iXV9U%܌EfPI{0:uݦjXF! H7Џg3m{x~|eXX#l`n:)Oٹ9E,Epn{⪡^C*\I>tY=ZÛ+EcyZBYX w "[u *y*+,B~ 9F' }-F6XmᵬtQbܐo^^+}U13t!o>d]llmj9O$M@PefsnǷ;e7cv4Ӳ,l[셾I$߰=:;>A>Z5J[W9hi>kUDN#&T-vߴAu>a ͇?^rEFww~_8+f`ooۖǏE:MJW}ֽ[Mex޾DĐ.!'׿@cPnP,tѯ}?jB [na">Ӑ?P+ȡv`56'Ul`}~|.L(1%O{[y+kkxe7m`DR ӭX$0Hء 7}?$WIifFvk5ǺG~jѫ[6:͑ij5ޓu=dx@lNw;'¶#z52-{ΐb1;t/׿4#p?v~^+Ȧ.UpmO0]7yVEei:IR4/("׾y@jT(fdmΟm;_nOog.dӊ$쨳I03(cmSoՒ 'z8|9 M;i$v[S6ө9#tpQq}y#iBDiECQ͙9$p4emki8SA)ߵ^>t y xR )"81!jJ^u!O}ZA$%lַsړY0)/:΢\o6w7#r.?WLהulE;;!gsqeWB7gǿ8:3I ere%&Yr( .> PӍ$>7qa϶c.(W[.>q$F/q$}vUuz}%mCF3PK# 70nܬxn=~|^q2ƅk 7I췲4 ˚C Q8q4\ vP@oc=Ѿ:b2F ty0hC Һ cr4GÐ$[ B"Vu)!&᎗n(O(2ýsn.A3I܂"+7EQ_2}OmB4$H?UMv<4eҬ !Xyx/{>&ǐvoc}/}~ۆ$謌BĖ7xԚj;}|>>a_)[٦:q͵P <+;Poz #w\0?9Mză{06*A:|F0u7\t|O$1c(-@F .7 ?o7 ƚ*i1E|}!HbOopLS f[Iڀ>Ápou9,즒mO(Tmoa̾R5SkI4Z:8wk%-b,{Ì0n$=#I`?BvX}On#s)7Ht qlyCr\YmX{?.`p1uNv#b2$X} }GaG05>4 }iZt*_=° ,QC'(K#Cԋ[#c&j)m S-I΁3* V3?6$ysBld4򔡞XD!GQyk{E$Tk7mfcmu.X٪LpT>AC"d jiC$F[,4btӑԒ{B 5|/P9նD&zq9'2 eIHn?xh8e {OƃQ frhێ3 i/)a6̎fS s]ܟFvb6k1mq*R`Ԋaݷok2+m#Mu9JO 0>:}=#ti/1War#mqq㮧ƥJ0x $FE1]EԍoLjgvъ]L~4ңWmAqn[㊺R'#n4tyllV/n*=9)&00/n@kۉM:`jX:=.h+*Fð׾Y2Jk^k`n{q"{sqAϺy VUj4']. n;<}kS{h F=|Hoy/skr? HZuI.S5P{|9&)XWMl<>7ϭx~騵4cvq'w>ȋlpuAvה$yNm)Y6vME;}-y7q"X}#Z"TC ;5|I69(پɷFΞ5a+Bt Ђ~I SƎs)hA Z ;-xw?,1]|e`j-ZHHl }uvjNyXe+F s-]}n{95@ 6*l/!>'P&T b1͹Ⱦۯ9Ջ+RoSMUJQvx]k?ضhO~kutӓ"O#Jjw$h?D O?_ǧxSʠi{y E:7m!lT[qvaǑՈK4proq}u.|y&%{.GanxW6T'ڒnEе$oGpXvXD_3mgqf";}:f&6[`ߌ>*F5,iY %o~P;{9yO\Zc{Bw >g\@{Xm}m<ϝ][yY|Ypt3Xkh[V׽>b'һn!p5'#s3y3>r=x+ ϕ`lf;5M~Yun ƼHE(7E~٧Bt t,~jVHb1$v[{~Յ3@2x{;yc>&y D^[|~'i8 NB|GaQrJ>6o vֈsι+;moyTݻ}G4"dqm_1Jv$<*'YC!Rk>m̭O(kZ{~\P8U 6b{۟ߑXFG*$fNth-LʻІڟUO{7_h5=r'MFG @v:x ݵ4U=\k$2FloonӜiCmG=.$PpYt_vȻ\sx4=mݹϡO1S'K@ЂGtөLIgh6.㵵t>wk{ۮM< * ,Ω9B[ǜ#ݬ>'ok2v0u]6n}u9^M@:47[ٶWjwP|y.Blm ?dÍ9E,aomM7ߑ<*cm [x  N1IV<?/RXm t~;u%n={>Dy駣N+SVJ: ΗӾ~vmtЛJ KL4̕cqe&ָ66=ϴ0]7A XvooO_[+/iko`Z1hpHՀ2TeI#]mkh/Pt{=Q3Ž؞w>< yjXm;>6pYR%fcppA({*=u쁕e>e'{ZڝxqB;nn!AZTԞ:P7{ $p>%ϖI[O,F%&o6wP{ mr?q 6:׿="$Wm[yaUv;WK5cjŸ*vWU-yjf,~Hmē y։kb[؁#k̑Ů Tx4}nۖxsjyHB N$c Q^w=)wHQl]t6$[[5 uttп UkXjOoo$jQZ:X߿{}q(*:OŒ'm&kq8a4EQl_1<%H6n?=hIѠ@FDU=5Kmm;I+E[)J)t[7w{u?2Αrj-8U5*8g17*b ,~46܄}Pai bMBM{nRc!fruWv|FcyhIKw>q:iXӽƤgMlAώd@u՗9+ƍk8R%y_oxs5Lѡj-{ڟg:*m;(iXkjjq}qgu 9J zwqQ(.~`>QEbw؂}z·hZoBP:Xx ѪDl~m5?dsR/Exs#rYjOQy9ThW[}OKN:r76ͽ۹p~^Pf&x)(ɼjK<ÕqƩJ2Gt ##sUH-jcn]JW°j,H[\m}'[OaF|y.{[ݵ+Q#p1[[{O boUmG*b61 sDž~tw2؟6<#ez5IhQ}A"߀r{̛IӾjmsC9>Cu@Mu 4{ ;7b.d`mmA!"܏bG[vTJmW h\vvӆ3+P, :^}'oUoip:IXC, iv Qw~#Z4i}Ji}0ԈLed žk}ÃB#Bv=>)zT8ZY;]M:i9D#~}≏ej-U"m]FPS.a 7$[R|R8ؔSzg)B&Sq}u_0cv=5;HMTrA3"F#o^dB\Bu>+[S k[6nsN9;6TedYdB4νm!Yck^=qqUꓧhlWJ䛎^dH9i'NI9MsUk."-rnUϿU={x9e(zrSLjnE^7MtB,ʣڶ{ oqo#tXՈ#QG5ҜZM< E0'$Rc&jwJ6ƞ[X j5=i2_}/k"yXҠ]J76ѩyӑ#Mo ́5*@k񶃜iHSmm0+s .X頷Ͽ扜* O XfuӜd#Pk |xUi,k ˩^qYVGSy[*B@ٕӶڋΔ,e>xvq_lGIqnmώߏ85D[ b=Q?O2޳ [Гs:7ox{S84R2=67G$2-@:2^էmI00PKH>&?G wf?>9{@ K #ПAHN، mcarrU7TdVz@-{ ݻ.=?B#N{J#kuiS[BHo%iㄽAFӨmxMğ:sQ=+O4SKHe+)@] ƤΔ2BNs~Nn)oxQ$,yf~lSPT'm{|Oj4bNHϋyWm\sP>Tb;|F.AMosȡ lCnFbFMԹfCw[@FmkwN m]Tos:iA>*\ɞ%&iDU$*@S^Nu ˃ȥAr/ceDe>`hvȳoӣMنUY\{؁ig4|tP+r&.[` ]4 JH;EcvIJ_}k6SbrsxAݨoCߙC5ۑ᧷KH窕IK(`K$Ա`=G9~XrY<50RM%IvEnďhsX?w&Ź[~Hh~8ޢ6aKPT**:UB_Caq{%̢%u%I5k-c+{4DRl@~ǚJI-!PNpu3R8Ty>ݻX__i׎O򼿳nmH l} wVԀPA,I٧w>#ۉUAM.ry>}^{weI;l=4_n4GҚR,\\dn7I!:147#'xhjzp/R ؋~)i讪*L2`׳mv$_;( {~SMq27 s{\X/Xو(;~4BҚ"#c1,IB{ph1nvܐt [< Tm6P ~$9BJC0[ c`4=a7JS۷w\nKkc2,cfٶH͓WM2-J׵׶[1*t]ytjzzT= Rs>S)K6'yU fFE{^ 6E{mbsDe1wĎՇ7k׶b|9GAybtݼ=tHe68f_7y$GDT|NC7'sK̒{: ;\inE |O92e>2m:Oo0ÕL,l]\TY))o-F{mH#sfm|G "eAd(6~sA[m:ۨwq^w Ttڥ9kcqﭼ9(Y"\"7[=xf QT @ w#VwPe^w[ZiϏƕ5? #Y˒?SsfF^\.9B(A%{ߕf +aPsdP$CdY{vnjԒAe{'/=i5هOΑ>H39R0ч:n,<1p$\ >QFUmRkKx ΃MA=0w_axjTk_y?Z2kD:1 :hA߁̌d,y\ xW@ O=9{v)?U]$qwg$ve0bI>?[mz :R^v w>c@YOqmն +%.6X#/qy©K3-X6p3|t=֨u$ѻ$νs(VN'Oe Tc5ooGQW nS<$,312}y@o2;;l6_$<{;}_+JF;_|W5HȑƳ"_羿důq`БOoj>U+]ub}yVэ#6<1&g 4OBYMmqWWp j_[{>?U{& }ֿͨg;:/k_An{PX UIl4_~f $m^R#bRxX ntNk\mn,'<\G cq(moNʏ ƛqTbI&@$ -nh~rq±mo; ,M#8+#@V+Ȯk^ ;y53ct{wo$־*Zxt=mOpyou}> O[R9d jA 66ҪEgƐAqs ݱfMBtI> ZJF$$yd&@ {}AI$?[y$AgK}`}߭(p?*q+  xmN}9 |{X&Iǚ5"5A!lnܛO9[P5s]~|z1±ovJk`~>O2l15s}?Ǎ̚¹BۮJaO~pt" cxrϷWj hmomߝHʕ ~9&k w@@;X;sNwkk{yxPOuor&A _mZKkxyH*U 5/@mT{ʛ kg8BuQגgɈq(avv >g>[ ||m~Wʝsnw-4Ә}ONnjTp}׽eiSv#^lц4- ^b)h<{k+55ʳRw6.~hnx´6T7o!#` rM2SASǀNOP3Qp .v%MqNگ]8SyrrT}M=*In}RzR(o ۵{%?3F]AۯS1!rC rnsHsKiOl秞5xnXZ׺\ Qnc;ŷ{h'Gu5 AVRPpnK.onf Ⴒ]An:5yƺx㚙ZےI~~|XnMN(G=^5b2y7ns`ENdbdn:ݽ\ՉQ]i蕅 ܟ>7=9BVk֎:YM~2)vnDZoLOo>u+N3Eq_Rp:$):5+  a_tK?@1;Smk߽ƃέxPc8o(l/o84yj. c~spkǮ, +RT؋pw@NT,t+coY`ZEYJ{| ~x0B?$R4!H%Z6_1m`B{_ꚦڑ +KxK=;tSbxSgc( l~:Toy[P浤*EEƠ ߘv0 pqyo.5CN1HQ3n˾OBiEZ4(_קN;qI/B47-npƠ1ErNk)ed",|;c,^綺5ミ)NtO%,E0+G1p]X}|=:إ%kHK PY6saoHSEpnw=ƿqN<}*Kl;5c vXiae.uq o+f)c4acI5ݐ ^ߒ}`l<.GE5j<njFѵfSc='U%"ؓʄ4!qBQP;䕰-{Ȫc߸׋ Þ}ԔD>-ޖ;l{{]V X>cyIՀ~tʫ+?_{ 9ei_IQHM(O2V,ֱ[1M/ܝ;ǞBg8. ׅbh@7n8N"he)T@z‹=9fnnHܿnC"+ro4Kk+$[^ߟ#- xMέ,IX$^~A&u-+0^{>+ uTȦT`"c`<.B{\)e* XRbk߷m<9}Hu#};K\bj&K#>Btc{|8â R>kw6\zzhElvsEBz>Bkk ,܋N-'@+`zP˷u:OH#2I xjΝBt#3HXmyd؛}Z_rĘ5\|*uxܦe:q-#:f#ƍ$QSԲ"pcOpG9G TB , ƶ}$ϿiԢLbZ0vmQF}2Gq)TӧnBpƊc$ ..54'EQP瞊0Jlх rR2Hn*H[4)y++o{\ƴTaSmڀOvӰqkڧ<9L.eF)8΅l:/Bλn5cK6 +0!xζ=UʄMUrH*~[ZY!2T詿EMŀf ^PEn̻ ,lmu[8o>t.xQO4T2d.d/vbmnc0,eIö|HVs՝A)|., cO":WrBD&0ב1! C8Rt ]Gé窛'vdeJia2UH,C{.kbvw'ی-•$)YAv[`6h'_c-+KF]M"H)03mvA؅=F:):R8^/ɍt$/Ԛg@ן>J9s^5OYVk*؍M⎳.CK[:Uߍ5t\XH}lG`8t+TXB8y"35q{Xi !8zs4j [:/M#a%E+:(}}|YmCA qa`Z^|u!*DzGQ(.jyTZUXp4/uVycJPwA{Y14h[ns};];l^*Dv렵Ʒ|9bԖǁ`Ls^.'QO8 ěk/{mmp^qLG؉pMH#r>$}[oSJLjK""]NJ"fbwiρ:@n;Ekd ~$7|3@q(PFKp*[ySn4aVV qbM%JZ&%# y l_ù#8uL*NnB;6ڢ6=0yKFc_[E}eX_X^6U~VtՈ^xjh ZXu .u`,>N #y 3:G6۴Ʃ*$WBmx>18s N8:9S ~}la{ 'ȊG-a?"#oKfHMN};>\;QIP sr;{y*?J!$'q_[h anHP_o{RP9禰H%7>9G .=aqqLϺ$ӉH%MF(VoOnyF0駊RᷟҺi&u&䭍|I$FKn<~aS>p+]BTIf4 \M"v`x1[m9+dOL-˛!4j[!'֖iN? /̻XY[@ݿhƞ$hl|}Gi6P^F@]IXvے߸$><~0#;zkb 4wV712HR-ֱ64F<󶮓њϩN"=ɷkhA&/v[)|Niߒ$DUT B\mkloZOh{Rce\Q$uc{pf̠7qofR>=ʝ?*?ؒHN4vm2 0kjIn s5pc gwۛb7Ӓa卖 Ϗ^2F4ƱTɸ6 />~rG'[۰O_ڸ7[j }Gi%;UmN0FGJdk,uУngm-d#v I'];= ےM x}hG法1%GvϫyœqXNaGp=,A76c~y%$ ipn[$--1Лs8>X ^BAs9%m=![ʩ<WI1@m7#[~90i.IR 58ց;k+w0ѵ7g8MhXMmoa=|0mh 5;Ggݸs7׵c18#KkO*N58$ 5+ ^}'JDtUJ]pdVlcjk1 yMa`Ao&8sZk/PAm DF۹EtG=$@GyvRtǜ1,˥om[ryڮZA}:"3k}HM 6kO1;i @?Br*B_o[[5K6{/y6[qf>Ӱߎ?F,)nu=;kjwI[V-{sFn{؋Zy1T8#7 ˷yH=NƮA#vK(U@ 쾾 o'^;;Zܾi*K:7jˁ LXj]ͼv̓H6_ÿ~TƺA#f7O};vH63) ~{}Æ4 LQ\Noe {g%ZIU'08}FG6mۜ$Ihk<+v& a5)4QMnMPWMGyىv?U>vC@k: ><5ix~hP\ _귷evÛJfHFȦmA$̕2FXmr4[=Q߸)6:o(D瘦 9*4ڍϒt1K'cƒ q箞EB.fBG_ߝFMQ7oƁH.jF{]I_fg68.cmx0})\.2KUV RlSb?t~|uܭvSsW•LUE-"92mZ);󈔐 ڛhXoH[p8ĎU$i I|U!;B^|G1UT+l}ְ-=<4YnH[Xi{rts >\M 7Uojw)='=KF(P% ^xxG[j>66>x<h|Y#?m_bYϴ@T 5YPhV_oo$-'?_o6ºeiR*ÿ_uEƧЪ5X11\q`Ul}Ƞ*Uz C .-ab- 06kReSkۅ})ɫ둔zt L` ,XXnFEd>`2 4?~|iӲ[zQRrP@i_XƣKk,!q) d VoqkxDmGvt\E^2O=gepFpO8G+m sbIS)PbC#׷mw9^emZZ5mcPΓ`[ _Kx|#p G=GcvTA .v1JT~Ar~h ю7 ~T̾c!*˥7O#7[o~@ڎjxJF4v;)1o'7ME8 *b< uF8; ,{Z͓sT?ȡO}a>=s1Q~n\?ގbHk,򕅍p|;w%;Mϰʽ]IYXx06۱$E >'[jQ-yO}jS[C;{;?#-ρiy5Z$tʏyC hnG?}s6~< My`6} >r +^B/qo zyUɮ2뼋f>sc*k`T% p,OmnZ\FTYj8Y諥/bfr }6J7k-mpt`F={9JfByNIr;[7 }mN*N0=p8ӕMMZ!MkwʍbCv7:}z)#̩[{`mHc-}-F(LipH~vm.őa]knܼ 쪚 ȵQ [Srmo{p|s>{**Lh"vG 9`I;Zo '*#gU8Q+R8*{㱯*4S})RďF8ג+iθ h:ǜ>CpG<y[5J衐4Lwm{=#7sqn;[~>޺S# b4kS_>:qJ1sYA}t@;6.WڟikR䦧[o,C-wXi@򐭿o`Iυg= :L: J K?R=ۄ:[__^N,V-2\|=Af'BM"Hk>wa AG`EO4Fs0rop;ݮ<5$ By牭 McវB#RmK:ȓn;oc_Oӷ4Dmqj d]33}]RֱH$F"E{KsA3Mд3ѤSXXw}o׹ "VTP/۰Fǜj56@nV7=?ݵݯqA69㳞1Qc$- q{iۙ(<ԝW@gaf6 &Oeߘelc~n8}9is5p6>t}nAdwp H=-Nǔ}u UJ$F]Awyϸ$Xݏaߖ sS3ى: T렿1Jv[p kD&]Ͱv XAHHKS?d^W`$${@k*R~=G}l{~[ VEe4{VC( G=u\M9IypG6= >7#u6}/otܟ㮜V |epr iym&Q-a*Mcro6QplSp[y[\iD6$0G L% 57Н-R'M7I=Eˮ5[_N1~ֵﯳkrZQƹL;Iݠٔ?1ɻ߭X? Ѯ)_8H%U *[s+6ak|,Gϟ*؃XQBK}k 1"CV7bH>>*s4N8 U `"5YE 'I϶x&E=׽$*XAq`6qn"*"GrMkÓPMeGOmjү5ԝvmhF'94$g6JM%J@f#lJ/}xINɪ{m~w#dt?zkq ,iDp^ÈO ̧rRɰ= `i6E|鱘bWkN@ %m1HېQÊp tQje<"NlzeJH,@7n'OO9aRđEe pHy4+u٘2 "Ta|Ži05pSz{ϔډ+(J͎i?|9#)M;)֢EC{KT O 3RTpK(Ymbu׽ysD@ok\_-m~?sR[0,Cu:uy:R^bK{khOQa 'ˉ BX&m|,5dž¶v(cQe k*$[<կma6c۝VIcmGog; XuAkZ{s5 Dx61p9TGZkc{S4kJNkX=E|9o'nXk>8օd@)K;@:uO%ް}|l 4TZWݍIfŮXkO8lڅ@v^xתD " P]޵ idF%(ElySp-BZ 6r$ o J&o瘧EGxmMFchPoNkm֦vtԅ%v {u$#K"yrk6ٲSNA,6ѵ&X0mR9s OF4lA.{ SoJ$]A/va.SǸX/mE;wx '4΍y^2l]1B@>]dFeraFZ@6$V4JÞ&4iXpX; 6s8 [oëOm5teIVSOIȁOk8cb(Z@-?1^eX'B;o2\˩ _]s5eaPc@YH^Q0faCo~3]#<$A9[a @$[߱#pA2B#q:[\$s%({8ykAXԆrA>˙c!{v}mV +y~đc̏&\X)ox~5+K; t~IvmxsZ5&쵁БӜ}rin~Ұ8<^ 6t l'BG3 :HA{\¯eq"[3[hacus]l lH;㐙X[Cbd8jۚ1# L8d{= vۜ eVbn~$ZNWn5Mt@n|~fy=/DŽ@iebG"{w[kh>Ʋ_3vN&ڟGyR#(f!N[m.[}<{;OwO|H'btmskLSC# H [{ݏ0j@WYHo@=ǜ "IDF"K}#H}8a",b_j{߭f Fk猁r$ hp-ax*J]C`h~i\nknwsoo0+XX|ȫfyJ|mkw=#/r/e`Z tZ].GЁpH(;QXň?ۧ.N8]"!6'Vt @+$a; $_Cvj*o_ŀi"6iM{uB{.ov #2$>+Ml` 5xR!-ؕcP}>>#ׅbϖmF:߱aw$z8Lmצk G4#Ei~<|͢(Ա?Oq8A¦E;؛h/ ;BHX'q}Gqzfmvr7'hp4>̂Y6YG~7n㞀vյpFMklΣNǜ u$\~<وRC(6 =6q*-:;NO=jl@v:0s{<>^zjN5*ev{ؐM! rOks5sPH_~D7c׸r k[zZ8FCm?OM~gPQ om G?CHc]m4&.>{-3T@lhqut0H (nouļ:ݯ{ ki;Qb;}]Ú6sVg Dam,}sqY"y^Y u QЃqq3"6{yUkZs_t^o=A,dC~\E0H+yPXu" X">>ߦk+j\B3a{w6`yxVWXE/G7k[Qfc׿oTUӎڋ'.oe6Mm~Y-~Uk"F[׸tG1;Κ{-͊<*dFHP9K}=|o~ݿl@o<'gMpLhS$/[v O#*=ƞ`[8Uq{[k[roj~_i:9ks"qtVblG$}G $rVeXj,7n _V0#axP7*y\G[y\L[w=[Aǜ/331M`dsVGQ4 aF,}|UM6w==scyn]͵۾yc ~DlH򩔭[$R맴|9@_xXjڍ;|@NM&d Oݱ6rӟ:eޅP؏vJu=~׿{siϷʜqhTqC+|?& C}¸M2If \j.mmoɳ^5K m|딖X[-lG_Fu >kjxTWHD;v0.-{۵'OiÚԈc`.#ۥοՈ+d7ml@7nE %koo9Yq}Ak{rLO5D"v@\5AJ=#<ܳX_R}râi EH mPUSuerMފ9JmY/rl}ܨQh*9i1!zxb*E) P ؐ@ݹʖ@OMFzBqZL'=d;Aֽ8C T>'V<+8s4}#Hv'R.o?ǜNmn>gy NRoFX{t+Wb.;mo==y•Xu9*Bߤ,Taw}Vy @{r: T fŒYd~6TX}KHb\!] xK%izrWsovk<1IJ``8VvGg`i;Ok{: 4+@7bI豵4m癬dn}7jB_cZ_M a{i"YiJBou-B*,;:y窪;kVmװacNnkqPpzNH߹ۮXaܛ`;\v]; Ki۹=κ<+&**]vur:Z@X 's+Z{o!'B?wN[Xv׿gj5"]{ah YD|0[7gu:xXra_KmqRnBpQǝ'/5{-ME":kMaiOҧbl,5#]~xqJlQ,]l<4D}Z3ϻH}ۿvx^sT&ﮇjQ;*'g&YP [MGϜ,j՝yeG=|S=$?-%$j ^S5\q24g]"fx }-R%9UROjc `a%qb;hC'Ga˔b{)̎ek52:?*tDt7zn`x6). h廝=@̉Q 4 'ۡQjiFzDW @ey' 4rQ2J۾RFikA]C|%+Lݬ| 63 _mBĜ>yPD[3kbfE5XnDԓeE&v#*4du~rBDo{j u>^kvέ p;|:xY84s0SDK4Yc6UMJc$P+hC[P Ðc*ƓyR+o%5Id*Ȣԓ k+#8!I?a~Vq‹b|qA.Z㰽=_kg]\eSr_B,t(u"wʂ~@'b܅'h @{B藺Gן1MFlBSR B*m- nS#/Ү瞺Mf(Sp5:{r~ES5I/&aBAMNMC*o}8HvUn=5UEu^oOOf>x'hs#O<)B[xVXFNoForD7$ˡ^㵻rU>~Ld2-fo{dUBm ]PFϭQ:c=UΡRI-!;H6?um5Aݎ#[_oHV.|*jh]\  'qM*ݙC+Cv7+N8Sڈ=#<9Q$'C9Vebi)eUbf&-Q}i$y $qm{xs D3yX_SG@9s44EMQrj۵Ɨ?|ρamO ҝyWr}Z`.?z]4񹱲_CoOx] =|O}9m [ t  h _ة;Ӕ8BR( $>7v݀ }r6V5P+Yu7}rl|NSq*}7Ԭ`7UHGHqc~&8עkRj;IӉHtTR֕urq'PGsQ'x}`5W vv7pm{܎0}]}WHW&* P#*.b_$[{ZCvקp%thTwXix|8&h} OGQן('mC "U-\Nn|y:Vi,@[hs!+clT)io n J:`:r|NJkpx+v{"ң(f/pqۙ6tq{Ȋ)HxBbF{HTMͿ[wǎN4Ùl"_{.GO8׀.ZacO$o#vQ6۶w<*æ{0;.$9$mOi')n#mqr1X]{/yb8yV3sl>r}u*ήLmD7(|@^G5roxmn8Ucϟm&kt#T[؟'eEStb-}~nf[6-9; 7iq%*6 A^2v ,I^c@c:۵~DžO<#Fm2@vA|oΚ5f #]<5˃\[k OycºIhЛܬȡnmakkϥTEpP^^,I:{M`d: 1ot;J&91tbVt?0jabFf&nmx{ڰ\X0 *N#ncІ(I>|m.vyՈEt,sn{O: HZEi$m$~Hee`F3s: .E=]/eH#~VW$R{f!M|tsf hl49sƝV?qEPʲoim4?9mum>rxr+»"*.Mŵ i\ EyChk!tb:I$k u'y3RRĊ_R.ﳻ}Lmᶫ Q6p}e!M;M4+twb,|w#a}Et8aA|-T"|wtK\־&dYi}øopzib_v#M4Bu:p>wssJT)[bͦ:rgw#6& %M+ 7D'vF?Eƞo41=ie"Q9TyȠZ+5,A6x=4QMBQzaŝfeacb4r﯇DG$7:ks ݸh*( QbG$ c6[ÿ<@(Zݾ[M r#L=ٻ0_ ߽=E݅h<- V"Bݥ]l>c6KOwC'^UF:a<'|,=sCw4O;jR6u,r<<}KsY3<yUv+{ڛrx%@ߗnzz9c MMKbpG0yOnVmUV+@$DZE<ӿ~^ l&N5dBZ ۅ\ZǝX2@}ÿG>v)tS{꣍6mm?̱D-`s}~SqV;-]=FR>u˄N<)>-I6}сL{]/o[90ҽ ,+1Y m'>vm{c.osr ENf2=ʏ s"Kv/g4Ry NZu,qV(cy.`L Mo[%4[U.cXHnDD$2^76txQ50KI*`3MŴ:;ȪX{]|n}~<)LeG8%erK\us7Qu܃ ^8W~ls;l@-[~s(`N"$ ؋wQه>sT$M 4$Ao}n6nr̻hNcRcr9ZۍfiFEOt$~s*Px}^gמ~T=),ćωQnܺ_>Ji{vjF[sb%'ċ\r*Ȭ*ѭZUpoMϳ_,Z2l,l@6EXci$o1Q"u$~cDO>&Ua^h$/ hTa*4g1 PX1ÿkv7^)UKidV[ Cb.ohk|yz 1gk~"SbIc9oj]NMOߞ0ɨ5Dc #tA3;[S}6|.{w- "%kp{v#%6כ)&+lcb6ˎw%BA]}.,= ĦHmgE%F9;[V m&8d].o͏Of.}'ƁV&q S*t7=;be1 [O~\t6VG%,Fnkxi[I~O_H\}ZS&h!t7-{ ? yi^Fbqr[Z}>ֺp_劣myXcYGUȹp뮼搪bF5X}&Rҽ@44N].a\X_~8G?:ITiCmejٮ?=9܌muЁrDjh؟0vM-oa7$|yʽ I/NEuLb|toRIB6M{߯H5eX h;$ x9{)p4_o,zҚ'V̱KxX|yY6/qkxẃl6~53&t:k|!,on_t㶓ΥE *UȠﷺ${Gko@eVau|T>Q{6'Ӵ2*&*\I۩?-甎y0V`v:iD \ V77b PL@Jؑ}')lпC.7o7{b|MpƱDqAQKnxQn`Ѫ091V,,\ݘAe@{XΪe"r{@FDJTGu i}u`.-WWSQK3p-k|O @g:e ݣs>o(Ҋ*ioKB;TVI767[iԷs4Eܸ’X,D ;r:ǷXQ.JqiD겅w`4أ?2bx@M<6VzHiq,;^k[[^S"EPWJahll@!7v{kmuÞh&A[~\+, Ѳ6 n7_۶ 9In~`*V)P@5@mMͽs!X -مm~X*v^+JӈVs祴~?w!mw/btGۊ?PȬafޫq\; 2^Ddm{}ӞZ0ښb \>a:W`a#yBմ$[bs`@` 0^;y²"-֝LE=8lX{[~{: O{5ɶ5F$k#5cq!um']~>sm*o`<49SqQ*|;6;$u/w椐@%iܡs!v(ŵr s@FsfV&X(ZڣAX<#2}ba{ o[&+{jCD]7\ca}䆷z)͔S$2W)(EfCn:k><ЧTQ42p؝5H~g[)CabB?hSTI-1?}[@Mu$e!n@&;߉1H,nJGaoI"sJcXoo3Y3(vcPX]P`,uÉ21:}'BOFTIլd%|B A&݁DžiCa  {?=B$i3_ (ؽ_ƨV&F7n#mHn߽uttu[‘>k[{dDo^2T7\Ӈo 0Mk53Es}ݴ_-)IU <{ #YT̕ H cfk]FǙMz-u5c v !T,iȰ!u: /d&^ j@=&ʂ|5 +2q5l6M9yO*)]mᦤO{kh˞F3%(\Hq[̱D ;=[öRAhtӃ&=t K x{!c鎣MБU|D}՝dV!O}<r[;vӰKjk#+D4fɇDߍl=mDF3<򀶧'OiTyl=K{&oz k0 vv:{$Y׵鱿oƁ{m:M{ 5_n~ =ﮣ6* $FFF$}x9bE&Il.Zm*î\< Ń5;TVoo\+~ W έrn4Q{۸9Ѧm5.8ZEs !w*cqs.ֵfZtJn56+nۿΌ<ٓɬNX#9JκEXTPH]Kw FR1SCrbER*t!%f=gÝ)V}_OWQ* kAbN{ =rH[uSQsRb13\D!KZq1׷17 ~kzzw a!/:K,O.n,,kMF_,4#,Ms) 7Ru=xG6GFyHw5;{x YBHUaIݯbC\669˓<4@@ZP޾w\ $j=Je: |mkf[m; k~*Dc?:a*KCkw|y6DZa˫sZY@"xT{HPI?XaC;ǁj\1*![xu`/} MO~RtE2/rack̠3 9#Gw {*r0әX$275攓W8zRI__OO0=5$Y>FZ&*D4f#u͵[~dٔcl{sQuEE4p|ĀIM _sAnUZ oÞ26s-_h(Až_ 6Л5;~_;t"jɽ@l@*w>aS窼7hK: ۮA}7{_y6=ӶnU=5`xTI][; xϡߵ1Jk~1YrI!{-kmuyb~'Cێ֎1Y@/ @$ksn|4<Ʒ$yq ) Ž?õJXr<iYb:B}"ʨ~\IȞy1qr<<9(:xL?u])鮚TO6K(P 7a_1Im#٩ybg˞xWNyдo9܍xی4LaR *j!*; qwoyK14%͘5n>axe1KZ73WyiTR6#P0*w{ cem@|G{x_ʝ#Jq%^k ~f̨|{pUliLɸYof7`~DfQ" 0kc_o0R vm'(U5ԟg~QGO8S]!qB/!ݞEٵtd7M v{{xa@s:M,QK _I><Jw[Rcc0@bַ}Ayx<-{[Iٍh 禳< V``{?.FX %/ocAOe<58ֆ4_L3#c#jӷyB5 ُZRC Z;ӹ[d1x 믈$||xF3Ȧ Eeaqdz/y&ݿ 4YX7"Md6?G PBBDThPԋG{a<ȌcFoz?# "1!dEǝcB r;kseXã^ ;vr;R|Oep@: ϝT$#<++v$%sruez'ldߴI )#/#8HZ}@|kncZyFo6}|2CpN[g ۷i}m縳w}l{ߗ}z~i u:2aTi{[vե wO”B`+ѡ>.W5p@m)6L`irioMq|qHO^kxY&U.#<碮Xs0WS k(} =MK4~D*#SrE\}'@{XaHQ"F'j "(Xrd X\k=_O*lL޸g kMok7*yz UZq=tLRv]}_tǒ+Em=O)޾vUM@6`!#$;}q*ZBdNIcm{GŇI{)Ny?R#b"hk'k3ҟ+io{mbНDBմ͈K,U1YH?FGux\z<%iqȕ5_Sq䳕oˎxqIgESCb5 "5Ik+1z{/)pŵ6'[A&廤h><"TI1eGu3J־:WC>%WY^Q x` ]4MNʤX.Yu㳑dPl75B `c(^DcVG :SWQbIk{x^F3^nSΘJDn p= Ӵ4@-@o¯,63P8mV7;Mխcxn)(?w;|=cIzE:3n1+2v[NtZxp)Lle* >Ńt+=\uUKYcPZiP,SnNemo`[4O8{vs`xsos ;@a-pocxO o<@gXD))mV w#n? xkh4V9SrSqôZxx~c4`H$xu劉gvVǟ³T1Qsau> ^dVpU=6_w4D<Ƽ<9 ^0 pnqm EcϭYC&_ت`4G029c/񵆚~|ُ:dƥA"U]'۩{r$ؒ\t=j|NB=Z"uM> I;ytM@{~{hngU6,^c mB]}x#hX(v$42M/rFM_$n 5ʩ:n aQEu,,Xwڍ{{4܂GʥRvUB"B)2*}X-t#Ù%uho 4H8V'.DK mOa~Og$-@f{v>0)B(e;k[~iS0jlLcϕ-T?֙M ;Yi`T/o۝F$+6TqPШ;o#̊hx;yO<+4[T8#iowK\$:@o4 bxxXnK~sGm :=,(UϝiD瞪Nl n,A{o$dzNoϲDN_X[#A#{eӵ9#:{3O$1X7aeUm"~6qW&+ Ȍ ͮڷ=9m`}<5Z"+h]]6?ߘŔ ^Ö8v~$kxǸ*6(]v+znۧr`{_ mƢc {3ۜHED sm;rxOTVēLP+Fm~\[[@Z ?^ܼSrLuWF}ۻ_)Nх;xo6ȭ^+ abq8Dɡn[`U"+!Zf>ڦ VL# T(ߝ,^a[ [=5kBǷ&Yd9`a^>)܍mqg'D$eba᥾ÙMC˘S^7['PQaW~7OM8:Y\;~rnw ikNU1밷#X؞tgK Z\k;6~\cCF]?c¨vT iM* ab~Mw簾9ҥF] nV_@/~dsT%RNhǔHßZ&DVEbK ݭGA.Hn_^V+2~}ySڃ?]ybkqyX$ X~[m}lQ[qRIH~\Xk~$SK]׽{[^UiajTWt3ws:^pjXZ@-խes:[ۏ4&iϥm#¡ErЃ?''7@ ÚI |iǟƱW;o;J6KggWU=Ւnrض{ 9 _ݰ ÿm{_*^vkkǣQ;{ii%Ypu|tmcfz^-&6ăs,*rv>>êS\)6k\k-:{Ou6=4QY7ȑnBA˘3qĝ|?[sgNcϙƲ=?萤Cp5g^Cgsy@*턁 A${nEXN•ZP1EPdP~ _nH=P;^jThU_Xxз6s7ĝEx$ȧ:%OT=tOil\_͎š)b)"{|ExEvӕŸx\X74vS? RUX$@٧2&ݥIЍ.h5e x:ksEpo U5PA{>Ͳ: vߗ,qƨ"C ` -Ao UnBݛ~Ⱦn0(?qNyVw:p\m2wS{><&簕kÄ@>b~1![Z;{Z#ǷDl7Rtԓo80$8Z\ZǜVFokv ymJ35Ttwa"M]Ic<*ZiB02E &4=O=#;nA w}98׍G8_i,-qk6ӿ1&96#:_]mooi2-Jl|@w><; ^j£O7`mu Ŕ>|A׹O<? VzW2: [E "o:۷-1N5!`x*Q,R,I7y2HipO߭KeG*X{R (w>QFEGm4ƣEH[arE`_ x|8uԩgU`(o obXwh_o:>bº_KiSښ_63`-N>I<YNk_~)a(PQS++VYZd #[cfjxb]?I{ԒJ SwGz? N|3UAGD2FWċ E;\wӰ?/h W<*@r{{Ü37ѫ|^=UkDB]O#)f~9:vΫY| ]I=۫`I'v}#pY4Amx6&Y 5c7y`G|5V't.Ѓel嘆~x$WqMﹻ }tRH1$mԒtmcy1W8W!P@69_/xͼoͣӞ³MO;m0&خ{ߘ$*xKhtqH󳦶OMr%Hӻ{oIm.Go6F1EgsF6'orw_F&nDM`ƷEg E"!W$>q%hG.U-vAZp(=Bc挓'^b{%>IIY*$u'("Dg8=42*k?Xy¯Q8!*^ہ$\O,zjs2Y 䭻w=gıHٍ;{A><xs_(i (j7}ߒ% +GJZ;plM${4Goq$|.c\U'NVMѨ!w5t7mG9TE">}Z8]#@`X[N#G$YXXhA< <*tr΍*`v{و:v7$A>=pv #T3ດkt|{yyb7v?Qۚ0Z :{m#if}2Q: }y88V,PLCIUCoU=LJkvn_n+[iȴfsnrYD 5{[{v1¼0;dww!il@6S)YlN"5%2vo \ZbAW.5j<2T;<On$C%߹}OӉW*l?lF,,xyy$km-`|;~G, a[U+w+̧FS\<=vd Ai?X碢-4y%7ei18㶽=F5k TpC`E'=淙n=>?z+`3SCBJ;5Ɯw_O><~ʩ&4N=Q)=\\s* {^͢d,Uo  %`8)`bk%PR/ܽrCƹSe~^VH¤|ijȫt% onhEbd>a@˛ғ ޡ@|nbֽ9:ɷd[uG Y$/aP*!r)OdSIOc'F&)yf,շ6YI&A\ߵdt~'~._Ls*ƒ<ƳE $9RGp*ޞCb/÷m>YVq -h%j y#'(;ؓp|y" hl ױb>><󶓹4V: 5߲Na?2T=K0y#6l5==jD[S*@ H% 4IN>\3vEGW۴_-*AH:h9ة/Ҩ2m k=pdSPlIǂjK#5N#U`( 4]Xa,rIm[oDždB5 z䯺GrBI7@A6[~D"ʹۍX0=wFXPMӿ}yNV J|Svf: {ڒ=s=:T}R.tjjv*k;Y틹i[og&7Gk(6R)^vHEߥБr-nHmA7_gǞzjms#Gw1Ԏ;ΪLaWVjU:Q~MxmBTX|{E&)7mi6"6R8MrVď&?^''أ_GJ$Rie2tPK0a'ul4n,I-1 kb7>&lh%K Xn{mRτG>fmRYNMaSCH'[rotvp{+%x̾6 {t8y?EBJa5T9X:%bFmQۑ, s9OrpF{NՀ5/,U[oec]}H__mxQƌUq h w,KGf 4nzk`mY R{Uwotx?G%1ۜIğrÚß};20 *g2:`tҪ'Bv|mǕg=5m[m (_B=vf mu (Ԃu-oGUXMM /@Up<==crmondw^k<NuuyI['qI)ي3};oo2$@ XF Ȋp׾^.KpێÝӥ]J[}G6<'O T&!YA&4au? Sd ش`Mo[s3U@[?ܠ:س{7y H.q@a=*ZQ4%FR kx|4&}8IspQMO33fRI{ /NO8Fܾh-k__ya!ǘKk_POg+c()Z}.I)hd2kj>:[p%B;B;|o 4ܠ^{Xv紅sJGaJff+`ʙ2E#MNQ{oo.9vyao8U'bd%$vӵj;rd+V\_M$ WXF)k!߰/ry;sǷ,EVHX K|ur: \l5ßm1Sx \7ݯ2b@*Xk} 停m >i*>\kDJ$: KG9"6$x=<_*ǜ+4Q6{'^_g91+UF):)Ksrߕiƙjl&ݮ^߿{q禴=U B2R\~e.k(;nwFJpaWW[H4'ni}8X)6?Zk#s 1<{ihtV?Ek}?G-~5q]K5Pcp,5${|?>v<8{jA_2FT{`=^HZ1b ٨=~2Q8tV\Zv}i x8d(Xڂ{r us==5B;Aqu] ;M4konyՉ*Dۦ%h׵ӾqIoL,5B݁!/с`[mω6q+E\Ui`Mǽny [k Gy"Un=ȊX9ī_q-^^Xb}=HyѼ*}wRn~sq8z)'mwLHT RECe$rP̛^׵5tzqy6&/h!A`mkAl=ˌq+RRH#[Vf'}5kjlIˍs*zD14w i}p>nr]wkvnVElkc&Hj4̭(YV4 ʄ)X u5s6^_FWfۃHb|>sJ5ܹN;j4J?s[19{yd }GnZƫp5>P=7bNºΞO==5`\ecI,\b 6QNI7/}=ή#MeͲHX Aw4ln[Cۧ"W j SްT6=-ב@U{}UlRC+,UFKn'%Gbu7vuVk$F}enOѡv]NX<w4Y& n:=@EVڂn},| 9?;jdR iqXPLm ݿxiǍ/#.ݫ vⓌyө$Q.! qܱYGM:bzv?d}T*q8U(#|$&䶒kaﭵAbJ7Pu.pZҰߛp;Pwr amOL*+㘋Jحotlvc><kn]&0 W T-Z~|R$5:m*1›NRjO$`lnok'Ù*&kju7\d`svFֽt~cF%b^xm{N2&cKO4䋋ۃ}sU)#:DZ kkon803W"D -}_g!15?d<{Y_y65&~9 X=NW)܋}ÝԲNT]#<ҍ:A'@յҨ*k(AgcsTn/§”x|Zx&%F2KTLUAkl{,8)/bDN>jcZI:[DћK_v9m$jEfeR}>8XVb/qʒ /Ji SO7oep1 BJ{RV:j3$Ĉvm;veSJPj0 fiډcߠ"R;EwqV]g@0s*׻x\c~iq㧀p= janJSkcH\ookVeogȱpV8cI\E _[m>y%@7и_x&D_T6Vʹ{}~X ckQsڧPwZcc7o$- UR~o8U8 c"ri<}\U`5O(I[9Ӑnr}FSp>|8PH~|¨`sG E k\Xkb{b0nESߟ?R#esRLAY}>p&xU^%[Qaonj5?^\I H2},iS1K0ciǚ8S|4\ ./{xk3Ĩ.mG}qgּ@"?^yƱRJXk=X~"Fc(7:OhN5-̀Q{(fѥWINތ#5%+q" moю {FHyƚut$\_"[r8zyW{sbA{p"I@oNWjtֱ[\j/8k 2PI7'Bo.C#=R/}m^xIۅPDy U?g{_\yvGnߏN: Tb7ZPG -N-?ʔڹ=+Pni57{Z>~fv uqvsUF=s{MbG_ik$= ۥ~iSOڙi(E:XhŭYPܖd/ >֙"LT0"m ry~XC}Gՠ´MrH՝or;9tn>ko wf1QXJ3QoݯoERSm睵H}sIn0}i{=DhQ #}ttU@w\ԯ>1+|-HAπ:VE{@|-yu?M[?ǕoV^xqYN%lK[]4ۜn;b Лn<|-ך&6Ӓ ces-@i70nܛۚIM6&sU$n u")FlŬn/{^q;#8eFUf!#m !O `d\\Gk<]DJg1I}u'r4E7 āq>=xLST#Q`ʱ 7[prsɫl5].,q؋ixsuU *D 8-{1<Z6Z1o?3PD%/}vnd)rmqM1+hV$o{y;7.]-o8Ϟe#y5"yc a%1Ƿ~\9Ymm "Ͼ<+Q>L,=w;|HU/9A~O9IDk\RVZ_[l o|۾G=U#}JȂ(ӹAmcs; lmzX16,Eǀ׿cvcbE϶&W4-o|@4>#YR5Qʻwޗ(@$x~魴7M1 "]Mr\tLa`F& p!0}m`<,oߝFɰ[k=7W0K f/#mH4`hUPvoyMlƲ]TevVS +) ӷuk8c0bR#rejTT:a~|:{Z_2f1#)Ā@m;//lr{_9O<>ulB@ `:\wW>JAU9E,q$WC3tvOi]oa#n13X$G dRm߾77;֎] ۱׷΂Pيag ]SHo߱> / ̊N {>8(5qD,uXN!-aݜ =ƇldhRB[P?|]ZJE\y>$"k`5{xtmRI'pƵnU%d ^7~rSʤ XFmiI#O<뢾_*5  -HOm/Iyi9eA}~;B8ŹRMa[4dȯ *S2Y߱ s6ܑiN=4RхIema<7i_݌jOoq~i]4TS ΄h.9d2#[K${;qN5@'met S..O:rII%? "ÕUIi`jda\joks-7h-s_G<*0̲YՀpmG~Nb"Y=am7w|yq򭞺̓u t辷rL4]R:gm5:{8P8R#W<5uev xTiߏF[lEn&q)7Y\3ud 8,K,=[oϕAF 3$ȶ"[[FTw [R{ ;8 cSXV A'i {]܍JY}ȵ I:X\[V;kI8 (;l aOOefѺ*bܤ.sƄ*NL37׾i Yu8ZzkW e~x'Icf1SX-'M}>~mA`)_jpׯ 5IZ--H<1Y.Mc#A%Xh#eR*0%CJnn;n]ʹæ1OMdyaUvRJ7o}t&ݽW9L4 ŭ抉q5kHskΤ7B;{t6 l<+zt}{$_9#@I#EWewiXܳ}UR۶}˞5q53p[Xhdu[JYIX\%^\"6U?i nPu)Rd onڰ:x9M+?RRIF2wGao7_ϮDsGXފKQ׷"D!;V:zjSG4v Ԁ~|&=U[uN-fkc}g8}][r~?Jpۺ?aa`kpb,Ik-{x}o<-Dǯ3^TYJ/'QT`Nop X̏:9,z)ǷI GH$TRzcTX[HǺHȰu.n><\8ObUj[ G-au{xXxUEEQϲssrUm6>:\xzuT(YؐX >vo/ֵƝdi.b[{jH#yFR7v{=j$ LҰ7g7ek?O~I#20skЏÞ='C)AP.Iq1`! >y`IÓU<+ M){%Ƨh;h{=[6Bi7Gsc&zqLU,1rveQcJmwg/)0ix !6bNm'?nH9mm۸rBM66ӕE<PFp&o˘CF{S65 5@@#h:~ߑMa~84Y$dUU,lMʩ儹`n[ߞQ(\)E@ap,A$m]Kb( <)IK;ԍrGe2@}?o)Mh%]!Hk"wDfwm iƠTOTmBtI#]y-\*4#qq ^8S0e`d MH w }|Uv}uӿs"*cT(IEa[NdUiH;H=m'PWd vtZo; _Kt&_ךkmb.%(P0 N5GUΫmy´MIĐ#1nkiM3؏㲻\H6mB2$n=G΄Swo>:s´kTD,-۬Mq|{*d7FB};`t0HҒ. m.m쪣~ 7:|y}jUO5.{*o YTv | ?8s"8&b -۵Ƿ0H5Όmsm5[45Kyl~݀v6.^{< &UN5i<ѯfb cߝJVn\}{,18V1$o"T4EM_tg ݽ۵ŴehTO%aSm;w<).}5@oaSO? 5Oa`,F㵮G11]؍Gׯ]6z X!|tAZ#[S{j~Ï mJt}0;]A6%+grlMvD>'& T!qeFk_h\4xa`Gn<pWHeZUam-r U mN# +}hU~  Vĝ[}FV8 [qvM(4``qLKϞvN)+{X|:㔐RFˠ@|GN>40HF5b2bHK2H>o1dN׾ߗ4xr|h5"@j}Ҷ:o Ă]}m`~S cJT[i# 5{A*AF ;ˎ碚VA,f@Gs ]J{(#C{r1>+wY<f,$xe95J}v#P[?S\LyUGwc0["vn>ϗƼ+^+vF[ŚtԞs00!7j~{U4DmHLAc`}'M~@& xZ{wz*E=d;X8:nax˱*A715%g;G ObdPI7\x[{rNIN=4-t3XȨX}3YPM[{~<ßuj&`I#Qbom[8Y\\{o/3c]Jw]7/w2blmf}ܞ"y ^37{HnKܑ?{_vU UV!7KavͲI6sk5ʝٶ@ն$j>w  h*c FVSQ!kZ>@1#U^C3W$3LC/q܃qӧ9 e1iԱ:}l*¦tg޶Ti>ǒMJ}跳8٧,TBBu[~̐Gw5'q5FY}6`ͯwe(#Rt=xz5 8.YX2*|4I>TlR]g̨h)H {{\xn"ɷq N_9c+93ު}~npt/b<'?<v #+$fǜВF!/ogk|?&61[+ T{ =|yِcӧ6j*$ij4nKKZ1-lkUM!,RSn7w8>P׍ oWԦX'PEd&[x3O @[u*ivw?m7q:)/OHuI%* 7|8`b7(kᮗpN? ]ZS(3PNP.:p7ckE?\lq$@O}>pEx fRF6Н;~w]|q}QyW#bgi&2[}~뮿P5o,o=u >%o?w?d0瞊RucV A> p2ج_[Ǘp8XxUذy0馂_s%^۴?~G\V<B,~ĒH%;X魏˓ oi!Uy&6s}-qoyc0ź${_ǿ{^fdych݀܃]X'5We:{Oa?;11~0AnN߸_t$,nA:{E*V[XX^7J&A0}y´܈X2?Qs;5@Dg)'iƼn҈.x $@)}7|~]]'9UqC;D= 5SndP&m#߾>㢹G#}l69y@NK /vք:~b>>=#đo{i{qqxu#4LYۃE۝`<_ۧ5lU$)'mZBnp;q2gF3YVI#ui&/suH {hxim9Ԧ9o{쵿SSZC(Rӵs]ljl, |9hmn-(Q~PMvF6kn߶ÿ<*EqSH-(V 4sV6$ZH7jw c`{|lm`{[2Hp|{# Ӎ?@[ح ϯDM|9=3>S${$v$|9Dr%HO-#fZуRx$wk0:Z]}qtءoQ}y>/_ZlOs} Ar;+_oG]9y!{AcX_I-|n[iZ8<cкvӜrwk_ÿ{O<|T(֞#{nA:?>H)(Yoa<*1{HfEW#r/m!#({ X~TeL4?mwk nDR^mƜoLfp- f6A Iۘd{ks=p8MI{X8`,`H$x_;늵MH"|A;rRXQ_{_VY*R cM\ܕo}/o{Ue2_ñ}O- +?ѡ }-k;dAt2p5fX>732Rm6>զF4Оg`uK?)pƢH؄[Yv-wy1j*̰!-!76-{y }'/n=ӏӓ6\*n{vCx>?G*"+boU+8 R5rMݾ?Llsw #xX|FdqGa{\|>7 ϋo︧I-v~p!\MmjWTteO񲺓A>SV祖X&݆=t˱/<;s#z}jsƕª"&d@ 67wטl0/b-Z>F<5?JvvC:GcS9`Avk HoNsRn WlcN4SRAK^㵵,W/ÛO+w9qKi"s.YE6ٿ@Ym"Qr oa 7FP{@~*Ҏ]7?+bt76ΐu'Vika")tA@Ե(` skX wRPK!2+ qbu9={jw:&zЛON@ 4ͷ}k_=\yZ JڕhUi$T:{u*|y;ww'_qqҚ %$ҡi)rpPJ܆kh׷?ֿo-$ 4ɭ) r}]:hGEu$B5:k{~,B<^~x(+=>t҆yW5h̏m~6ir.?vjb,nGok@ 5#”]mSd&@'۝[I$ H:d{j< >Y`v'ȪyF۽w9BC ~WfUi}EǜfX?,׽sh$ bd߹ #mm=G84Ǹmqac:߾s}~8*2 h6momNydO/;HCfUmoUyHeX6:axR@4t#+.#Mc -O$=:{ qj*Vyc-̞7 nR6` dƞa^TM)a,[cb4TAҳj:~g˔j%_:;h6ؖ! 3)4Pd #!JΓJ LxLo´{*!Th|HG7뭕@{- Oc^QS^4b8Zl[͘\y 5ԋh*R0ݷmWmc#_ܿoH0G8j֌ s.YܝHC:"V`%\K!rFg~B3P=r*IM`fs 0nc#4KI%&-.'ȆJiܨh2[KJLP \} ࡶ94T~sSRWUeQL@7rXI>,lsvӸ\j &NG*R#o8~tptƨkHbV -Oߩd;nw>P[$G8W4k.=ڃ{ww]NhXF/c-o$<ϽRs`y8V6KUQDc0VOz==IpUJ:G1<gwC%H 47`Lw׸mvU2Ox1R,ɹvb{>>KtlӰL.fgP酪+ 8E0m*S.P"`s/2)Hmį|xc²xq禲;|s QdYH bGI=H)P忢1+D%]cW#{)/r~,|y]p|;+l3[<侗7cYcA>b. {ysM p{ N:w8A^PAQe*33LPBnXyjI؋ϴqi0:eYc'p ,-X?lw&AǫV_R?ELV$bp4v6=bA3B'iV.ӬTo! U_.yM/ >+ ڏw+l~?.Fbq<}Ǯ3˄@76߯&#D3_mIߌIv.0m K(Z yӤf"A}R<쫅pyEPf R.8eӿkwtvyTiԴ{υ qca_=|i`<" BHx=2ч=>4vVȎ}1yn&vǑX)@".no{ip}rH<9AGOwLC$ k{#7˖- :q8s^*nv+"hIDQR;˷Ǒ3ܛ&rNʤǧ>*ʈ,:}9ʫT4eqU> >}a,ٽFKy{ {X 9c0en &7Q̰J3N}q#ǤuƢ13lEPou<2臾>ړ`yߕm4 {|{*TXkxtqoLhM smMyf?E6L(6ZUm;͌ATsʦ kF 7c o:Bٛ^y@8LA³Gpc].M'2JlP;g(_1¢H%WWݜI: }Ȓj~ܦ8־+bt%Ch5@n@KvÚP/e\t~5etsi8 l[o@;j#dTqF-{>'ŸkGG?!8|0Ҳj mM=j6A"'i"iByԥQL )<̯c<-Ǖ"0mZA쨦6F1q.N[x{%_kfh|3meQN~rwI`( \MLOM@ZK.vn606X E>Ž&="U3+gPWMM>YJ0[tQtLhB1kAO8Fe.Cq{vӛ90b7|@-8lE[fMhEތ`-A߿Vֽͯӛpƽ'x*^ ;}O{5JF\]#_ts}{k5`X[יDd Hr8xJ ƈ\mar nbl5׾.*謰 ,>>?W"h>{kkֻjR8$JPd *s~l$n ]dmvƥJOkiU0EH""bĀ ;|Fu,'a kj+Ѳ8Ш!Bvct&wWpα* %o`Onqe2nojGzb8vv _^b X]Mn_ʽR<Ԍ5+ѭ=y&ǡ"ixκ֙4*+ ܒooo;|*Xۿn$ȹ"[K |?2 Es~7 5*?oq|[a6R]o@O`/2#5ƇB[jmmÞ|cz6TX^8$0; ]@,t?*JFZng}Q#Z7L.SF%eܺ}?qVu3Knmr 3]wkߍmĜ+^9̰.P{:rDx(&gm>iDFpV4`ޤ*knۜ]\ '4'T; \t'MFӿ;7̱ՅM-xsj5L@̅e~WA瞊IQYۭw#nH_OR\T:k~t(-}S\?nT>lFaoh90m@Ioh`F++M %mA:ߵ.XXEXtRih-8O*~43RzoI꽉@vAH򎝵:2E@vbm5T)7[Xxiwjs~Ƿ%$#t >7k>aj{(tyiŊʨ9f]C0>#8[dvSr@#^Ooo ƕ(UaPU:#㸓k~r9XM{<4&q¯cJ:'aMط;02;>|{^;(و䔨v @V͡x6E_ԜjEpU_^ ~o;VXha$i϶FV`۱_{s,>'[xX͑yɍ:x;3JKsp9yU܋>tMzQ%AԊqɒ X81X35t>7$i[x4U? $-%[(o q7<:Lӝt%l4`MiAJck[u[h;7-=O>ڸvj(3Q$vx#F`v C̉s;i(䖩숪A]o}.I{x׈u`ܑLVjzTkS$ =rm^;u &ζk nП{Xt}~4H$M6ԤTQkMsqk$)lF M%i| n~rKʷkv{;iߌ S rQ*^;iϜJ)- Xk[t9D{Fckrk E;{>qfto?8ע04a$@,o~-bԠ>so<·Nj$fk뭮m6C xk ʓD*ﻑ{h>:x\ȑRg'߹-#InoÒ{\:džݢk{8`? Tx魮ӷ¤`MV> OSZYԗ[*X?Wǐ!M+_x*~ef TI9!0\VWu;}RIpv[{ ;{y2*Ѥi}N$r'b-b[-o}Dw($kBy107^O kxyj+@}D]܂||;DcξBo? LSX)(Bj۽>#A˴.Q0H=;xۿYTF}5Wȥ${>=vRI¼і;Tk56E6%\=+z9VQl=\7__1,E$|{[^y8SxTOgkxs-O2:>9 HG*QZÑ1./p.E>'e6DG=u&THT3$>EpiRkwUn YZ')`ATP}x><"$?Sg?ghRF=y,HJ1(I[ߎI8l5Ҫt&vu:^''wHI#+{ʴԵ.qH7)\[4U[i5RR(]fưf5#-&3oxhOv]cvUي .C*A -@9ԎQDd?x`c msBα/Ƭ